Legnotus picipes

(Fallén, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cydnidae/Legnotus

At a glance

Occurrence records1 311

Data sources7

Biological traits2

DNA specimens8

eDNA detections16

Sources7 archives

Databases and archives Legnotus picipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 311 records

Environmental DNA4 datasets · 4 countries16 detections

DNA & barcodingBOLD8 specimens

01Narrative

Legnotus picipes is a species of true bug belonging to the family Cydnidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Legnotus picipes has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections16

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

219Cmostly conserved

548Cvariable

607Cvariable

AACTCTTTATTTCCTATTTGGTATATGGGCAGGTATAGTAGGAACAGCAATAAGATGAATTATCCGAATCGAATTAGGACAACCCGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes3

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Legnotus limbosussame genus11.2%Adrisa magnasame family14.0%Tominotus unisetosussame family14.9%Dysdercus koenigiisame order15.7%Carpocoris mediterraneussame order16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 311 records

Wild obs. + sensor950

Museum / vouchered300

Fossil3

Other58

Range

Area of Occupancy AOO3 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 408≤1 km 245≤10 km 240>10 km 4

897 georeferenced · 53 without coordinates

Open the mapobservation + sensor950

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 71≤1 km 42≤10 km 142>10 km 1

256 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence300

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	40
Philadelphia, US	25
NHMOlocation not on record	14
Tartu, EE	11
Bonn, DE	8
CBDClocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	4
BioFokuslocation not on record	3
Ugentlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
neflocation not on record	1
Winterthur, CH	1
Tallinn, EE	1
WGSlocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Metsähallituslocation not on record	1

17 institutions · 118 of 300 vouchered records shown · 182 without an institution code

09Environmental DNA16 detections

Where the DNA of Legnotus picipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys4

Countries4

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 14.6–18.1

Seasonal swing summer↔winter19.0 °C

Max temp (day)21.4 °C 17.7–22.6

Min temp (night)13.1 °C 10.4–13.6

Precipitation75.9 mm/mo 63.0–85.3

Air humidity59.0 % 57.0–62.7

Moisture balance-39.6 mm/mo -63.3–-2.30

Vapour deficit765 Pa 682–893

Wind speed2.50 m/s 2.40–3.80

Cloud cover43.8 % 36.9–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Legnotus picipes

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 311 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 311 records