Ledra aurita

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Ledra

At a glance

Occurrence records9 120

Data sources7

Biological traits2

DNA specimens9

eDNA detections1

Sources7 archives

Databases and archives Ledra aurita's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 120 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

Ledra aurita or the eared leafhopper is a species of bug in the family Cicadellidae. It is the only species of the subfamily Ledrinae that lives in Europe, including the British Isles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ledra aurita has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

271Tmostly conserved

364Tmostly conserved

469Tmostly conserved

470Amostly conserved

471Gmostly conserved

481Avariable

616Cvariable

GACTCTTTATTTTATTTTTGGTATTTGGTCTGGTGTTTTAGGTATGATGTTAAGAATTATTATTCGGGTTGAGTTGGGTTTCCCCGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ledropsis discolorsame family3.6%Ledra auditurasame genus4.4%Ledra dorsalissame genus12.2%Petalocephala arcuatasame family14.6%Tituria kaihuanasame family15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 120 records

Wild obs. + sensor9 006

Museum / vouchered113

Fossil1

Origin

Native1

Range

Area of Occupancy AOO17 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 2 624≤1 km 707≤10 km 4 473>10 km 95

7 899 georeferenced · 1 107 without coordinates

Open the mapobservation + sensor9 006

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 47≤1 km 27≤10 km 22

96 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	22
SLU Artdatabankenlocation not on record	21
Tilburg, NL	16
South Kensington, GB	4
Bonn, DE	4
Radicondoli, IT	3
Provincia di Livornolocation not on record	2
NCMGlocation not on record	2
MZLUlocation not on record	2
OSUClocation not on record	1
Museo universitario di Scienze della Terra di Romalocation not on record	1
BioFokuslocation not on record	1
Tartu, EE	1
Philadelphia, US	1

14 institutions · 81 of 113 vouchered records shown · 32 without an institution code

09Environmental DNA1 detections

Where the DNA of Ledra aurita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter12.6 °C

Max temp (day)20.7 °C

Min temp (night)12.5 °C

Precipitation52.8 mm/mo

Air humidity60.8 %

Moisture balance-73.3 mm/mo

Vapour deficit754 Pa

Wind speed4.20 m/s

Cloud cover42.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ledra aurita

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type9 120 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 120 records