Lecanora albellula

(Nyl.) Th.Fr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Lecanoraceae/Lecanora

At a glance

Occurrence records679

Data sources6

Biological traits0

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Lecanora albellula's data was compiled from.

GBIFGlobal Biodiversity Information Facility679 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF679 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lecanora albellula has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOQ717425.1 ↗332 bpSweden

ACGT

CGAGTCAAAAACACAATAGCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG …

Lecanora albellula voucher PRA-Palice10658 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type679 records

Wild obs. + sensor336

Museum / vouchered330

Other13

Range

Area of Occupancy AOO1 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 141≤1 km 55≤10 km 131>10 km 3

330 georeferenced · 6 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 25≤1 km 43≤10 km 34>10 km 14

116 georeferenced · 214 without coordinates

Open the institutions mapphysical evidence330

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	49
Uppsala, SE	49
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	38
University of Gdansklocation not on record	23
Vancouver, CA	22
Wuzhou, CN	18
CJBGlocation not on record	15
Polar-Alpine Botanical Garden-Institutelocation not on record	12
TSBlocation not on record	7
SLU Artdatabankenlocation not on record	6
Institute of the Industrial Ecology Problems of the North of Kola Science Center of the Russian Academy of Sciences.location not on record	6
Philadelphia, US	6
nbflocation not on record	5
Bergen, NO	4
Olocation not on record	4
MeiseBGlocation not on record	4
Berlin, DE	3
BDBClocation not on record	3
Stockholm, SE	3
Göteborg, SE	3
UFMSlocation not on record	2
Bourges, FR	2
València, ES	2
Chicago, US	1
Repubblica di San Marinolocation not on record	1
McWane Science Centerlocation not on record	1
Uniwersytet Wrocławskilocation not on record	1
Madrid, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1
GZUlocation not on record	1

30 institutions · 293 of 330 vouchered records shown · 37 without an institution code

09Environmental DNA1 detections

Where the DNA of Lecanora albellula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)