Latrodectus mactans

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Latrodectus

At a glance

Occurrence records7 796

Data sources11

Biological traits53

DNA specimens17

eDNA detections15

Sources11 archives

Databases and archives Latrodectus mactans's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 796 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University53 traits · 14 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.99 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements14 literature sources53 traits

Occurrence & distributionGBIF7 796 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT988 Mbp

01Narrative

Latrodectus mactans, known as southern black widow or simply black widow, and the shoe-button spider, is a venomous species of spider in the genus Latrodectus. The females are well known for their distinctive black and red coloring and for the fact that they will occasionally eat their mates after reproduction. The species is native to North America. The venom can cause pain and other symptoms, but is rarely fatal to healthy humans.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 14 sources

Wolff et al. 2022Loiácono & Margaría 2004Pekár 2014aMain 1964Barrion & Litsinger 1995Marinov et al. 2014Keyserling 1884aKaston 1972Butler 1877Greenstone & Bennett 1980McCrone 1964Daly, Daly, Hill, Bogdan & Dart 200Birkhofer & Wolters 2012Pekár et al. 2012a

Morphometry42

ALE0.17 mm

AME0.17 mm

Abdomen height6.6 mm

Abdomen length6.8 mm

Abdomen width6.13 mm

Body length10.35 mm

Body mass0.169 mm

Cephalothorax height2.46 mm

Cephalothorax length4 mm

Cephalothorax width3.06 mm

Chelicerae basal part (paturon) length1.23 mm

Fang length0.55 mm

Femur I length5.46 mm

Femur I width0.85 mm

Femur II length3.5 mm

Femur III length2.8 mm

Femur IV length3.65 mm

Femur IV width0.82 mm

Leg I length19.76 mm

Leg II length11.6 mm

Leg III length9.15 mm

Leg IV length16.8 mm

Metatarsus I length5.83 mm

Metatarsus II length3.7 mm

Metatarsus III length2.5 mm

Metatarsus IV length5.1 mm

PLE0.19 mm

PME0.16 mm

Patella I length1.8 mm

Patella II length1.1 mm

Patella III length1 mm

Patella IV length1.67 mm

Tarsus I length1.93 mm

Tarsus II length1.27 mm

Tarsus III length1 mm

Tarsus IV length1.4 mm

Tibia I length4.67 mm

Tibia I width0.67 mm

Tibia II length2.5 mm

Tibia III length1.85 mm

Tibia IV length3.8 mm

Tibia IV width0.61 mm

Predation4

Hunting guild 2aerial web builder

Prey OrderOrthopteroidea

Prey diversity1.63 mm

Web buildingyes

Physiology3

Resting metabolic rate0.001 mm

Venom toxicity0.78 mm

Venom yield0.19 mm

Biomechanics1

'Primary mode of locomotionhanging

Defence2

PredatorBaeus latrodecti

Primary defenceBatesian mimicry

Morphology1

Cribellumabsent

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Latrodectus mactans has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes2

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes1

BINs2

Where individuals differ — all 28 variable positions, in barcode order

14Amostly conserved

22Tmostly conserved

54Gmostly conserved

70Cmostly conserved

97Amostly conserved

103Tmostly conserved

106Cvariable

148Amostly conserved

169Tmostly conserved

211Gmostly conserved

217Gvariable

268Amostly conserved

271Gmostly conserved

284Cmostly conserved

286Amostly conserved

319Tmostly conserved

322Amostly conserved

340Tmostly conserved

343Tmostly conserved

361Amostly conserved

373Amostly conserved

433Avariable

436Cmostly conserved

472Amostly conserved

490Gmostly conserved

512Tmostly conserved

538Amostly conserved

604Tmostly conserved

AACTTTGTATTTAATTTTTGGTGCTTGGGCTGCTATAGTGGGAACAGCTATAAGAGTTTTAATTCGTACCGAATTAGGGCAACCGGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Latrodectus hesperussame genus8.1%Latrodectus hurtadoisame genus8.6%Latrodectus garbaesame genus12.1%Latrodectus pallidussame genus12.6%Thymoites expulsussame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Latrodectus mactans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size987 780 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Latrodectus mactans0.99 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type7 796 records

Wild obs. + sensor6 114

Museum / vouchered1 671

Other11

Origin

Native12

Range

Area of Occupancy AOO21 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 3 350≤1 km 667≤10 km 358>10 km 801

5 176 georeferenced · 938 without coordinates

Open the mapobservation + sensor6 114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 1 423≤1 km 15≤10 km 66>10 km 19

1 523 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence1 671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Secretaría de Salud de Guanajuatolocation not on record	1 185
Ciudad de México, MX	192
Mexico City, MX	64
Denver, US	31
Buenos Aires, AR	30
Champaign, US	29
San Luis Potosí, MX	21
Sam Noble Oklahoma Museum of Natural Historylocation not on record	13
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	12
Frankfurt am Main	12
Los Angeles, US	12
Museo Nacional de Historia Natural "Prof. Eugenio de Jesús Marcano"location not on record	10
Ohio State University Acarology Laboratorylocation not on record	8
Cambridge, US	7
Sydney, AU	6
Ciudad de México, MX	6
Chicago, US	4
Albuquerque, US	4
San Francisco, US	3
US	3
Tasmanian Museum & Art Gallerylocation not on record	2
Lubbock, US	2
National Biodiversity Institute, Costa Ricalocation not on record	2
	2
Washington, US	1
Royal Saskatchewan Museumlocation not on record	1
Auckland, NZ	1
Chicago, US	1
Natick, US	1
Royal Museum for Central Africalocation not on record	1
Cincinnati, US	1
Vancouver, CA	1
EL PASO, US	1

33 institutions · 1 669 of 1 671 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Latrodectus mactans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 20.5–28.6

Seasonal swing summer↔winter14.1 °C

Max temp (day)27.6 °C 25.9–33.9

Min temp (night)19.6 °C 16.1–24.5

Precipitation94.6 mm/mo 50.9–128

Air humidity57.2 % 55.9–66.4

Moisture balance-30.1 mm/mo -128–-11.1

Vapour deficit1,142 Pa 927–1,731

Wind speed2.70 m/s 1.30–3.80

Cloud cover28.4 % 22.7–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Latrodectus mactans

At a glance

Sources11 archives

Morphometry42

Predation4

Physiology3

Biomechanics1

Defence2

Morphology1

At a glance

Genome sizehow big the whole instruction manual is

Record type7 796 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 796 records