Lathyrus latifolius
speciesAt a glance
Occurrence records99 167
Data sources15
Biological traits142
DNA specimens21
eDNA detections24
Sources15 archives
Databases and archives Lathyrus latifolius's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility99 167 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources142 traits
Chemical compositionLOTUS · NPASS89 compounds
Occurrence & distributionGBIF99 167 records
Environmental DNA2 datasets · 6 countries24 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB · GIFT · GoaT10.1 Gbp
01Narrative
Le Pois vivace est une espèce de plantes à fleurs de la famille des Fabaceae. C'est une plante herbacée spontanée en Europe et en Afrique du Nord. Elle est cultivée comme fleur de jardin, appréciée pour ses fleurs roses s'épanouissant en été. Elle est également appelée « gesse à larges feuilles » ou « pois de Chine ».
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYAusTraitsWCVP
Size & morphology28
Fruit length80 mm
⚠ sources differ — AusTraits: 80 mm · GIFT: 85 mm
Fruit length max110 mm
Fruit length min60 mm
Fruit width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 85 mm
Fruit width max10 mm
Fruit width min6 mm
Leaf length40 mm
Leaf length max90 mm
Leaf length min30 mm
Leaf mass436 mg
Leaf size7 017 mm²
Leaf width17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 10 mm
Leaf width max50 mm
Leaf width min5 mm
Petiole length3.5 cm
Plant height2 m
⚠ sources differ — GIFT: 2 m · LEDA: 2 m · USDA: 0.61 m · TRY: 0.558 m
Plant height generative1.25 m
Plant height max4 m
Plant height min0.5 m
Seed length4.88 mm
⚠ sources differ — TRY: 4.88 mm · AusTraits: 3.5 mm · GIFT: 6 mm
Seed length max6 mm
Seed length min6 mm
Seed mass44.64 mg
⚠ sources differ — TRY: 44.64 mg · LEDA: 44.87 mg · GIFT: 47.18 mg
Seed mass max50 mg
Seed mass min44.6 mg
Seed width5 mm
Seed width max5 mm
Seed width min5 mm
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
Flower colourpurple
Flower conspicuousYes
Flowering endJul
Flowering startJun
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formclimbing perennial
Life spanperennial
Lifespan categoryLong
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formLiana
⚠ sources differ — LEDA: Liana · GIFT: hemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number15
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberobligatory
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit typelegume
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Climber
Growth form USDARhizomatous
Habitat GIFTforest edges, shrubberies
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeelliptical ovate
Low growing grassNo
Root depth min12 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min140 days
Leaf dry-matter content (LDMC)343 mg/g
⚠ sources differ — TRY: 343 mg/g · LEDA: 220 mg/g
Moisture useLow
Nitrogen fixation levelMedium
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min26 in
Protein potentialHigh
Salinity toleranceNone
Seed longevity index0
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5.8 pH
Specific leaf area (SLA)25.12 mm²/mg
⚠ sources differ — TRY: 25.12 mm²/mg · LEDA: 17 mm²/mg · GIFT: 18.7 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound8 000 per lb
ToxicityModerate
Veneer productNo
Other traits6
Diaspore typeseed
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit11-100
03Chemical composition89 compounds
Compounds documented for Lathyrus latifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Neolignans12
Aporphine alkaloids $ Isoquinoline alkaloids9
Aminoacids7
Eudesmane sesquiterpenoids6
Eudesmane sesquiterpenoids $ Neolignans5
Documented compounds89 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-alpha-Pinene | present | NPASS | |
| (+)-gamma-Eudesmol | present | NPASS | |
| (-)-beta-Pinene | present | NPASS | |
| (-)-Camphene | present | NPASS | |
| (-)-Caryophyllene | present | NPASS | |
| (1,1'-Biphenyl)-4-ol, 2'-methoxy-3,5'-di-2-propenyl- | present | NPASS | |
| (12R)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-18-ol | present | NPASS | |
| (12R,13S)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaen-13-ol | present | NPASS | |
| (12S)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaene | present | NPASS | |
| (12S)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,9,14,16,18-heptaen-13-one | present | NPASS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lathyrus latifolius has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes5
GenBank sequences10
eDNA detections24
Countries6
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATC …
Lathyrus latifolius voucher CCDB-20330-C11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Lathyrus latifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size10 063 620 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Lathyrus latifolius10.06 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–142n range14median14mode66records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1466×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +13
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — COLOMBO P., COLOMBO R., MARCEN C., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:517-525.. Inform. Bot. Ital. , 10(3): 406-413.
CCDB · slov-fl — Hindáková M. & Činčura F., 1968: Angaben über die Zahl und Morphologie der Chromosomen einiger Pflanzenarten aus dem Territorium der Ostslowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 181-227.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt
CCDB · brit-fl — Davies, A.J.S. (1958)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2921
CCDB · poland — Pogan E., Jankun A., Wcis?o H. 1991. Further studies in chromosome numbers of Polish Angiosperms. Part XXIV. Acta Biol. Cracov. Ser. Bot. 33, 25-43.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Roy, R. P. & M. K. Singh. 1967. Cytological studies in the genus Lathyrus Linn. 1. J. Cytol. Genet. 2: 128–140.
CCDB · ipcn-api-dl — Verlaque, R., M. Seidenbinder & P. Donadille. 1987. Recherches cytotaxonomiques sur la spéciation en région Méditerranéenne I: espèces a nombre chromosomique stable. Biol.-Ecol. Medit. 10: 273–289.
CCDB · ipcn-api-dl — Wcis|1lo, H. 1991. In Further studies in chromosome numbers of Polish angiosperms, part 24. Acta Biol. Cracov., Ser. Bot. 33: 29, 32, 37.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 19–20.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Schifino-Wittmann, M. T., A. H. Lau & C. Simioni. 1994. The genera Vicia and Lathyrus (Leguminosae) in Rio Grande do Sul (southern Brazil): cytogenetics of native, naturalized and exotic species. Revista Brasil. Genét. 17(3): 313–319.
CCDB · ipcn-api-dl — Nandini, A. V., B. G. Murray, I. E. W. O'Brien & K. R. W. Hammett. 1997. Intra- and interspecific variation in genome size in Lathyrus (Leguminosae). Bot. J. Linn. Soc. 125: 359–366.
CCDB · ipcn-api-dl — Bos|7caiu, M., J. Riera, E. Estrelles & J. Güemes. 1998. Mediterranean chromosome number reports 8 (977--991). Fl. Medit. 8: 280–287.
CCDB · ipcn-api-dl — Fernández, M. P., F. E. Narbona, M. d. Ortiz, S. Talavera & F. J. Salgueiro. 2001. Números cromosomáticos de plantas occidentales, 892--906. Anales Jard. Bot. Madrid 58(2): 344–345.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975a. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.
CCDB · ipcn-api-dl — Seijo, J. G. & A. Fernández. 2003. Karyotype analysis and chromosome evolution in South American species of Lathyrus (Leguminosae). Amer. J. Bot. 90(7): 980–987.
CCDB · ipcn-api-dl — Tosheva. 2003. Mediterranean chromosome number reports 13 (1339--1343). Fl. Medit. 13: 365–369.
CCDB · ipcn-api-dl — Badr. 2006. Karyotype analysis and chromosome evolution in species of Lathyrus (Fabaceae). Cytologia 71(4): 447–455.
CCDB · ipcn-api-dl — Yamamoto, K., T. Fujiwara & I. D. Blumenreich. 1984. Karyotypes and morphological characteristics of some species in the genus Lathyrus L. Jap. J. Breed. 34: 273–284.
CCDB · book-ipcn67-71 — KUZMANOV, B., & s. KOZUHAROV. 1969. Chromosome numbers of flowering plants in Bulgaria. 2. Izv. Bot. Inst. (Sofia) 19: 109-115.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn67-71 — HINDAKOVA, M., & F. CINCURA. 1967. Angaben Uber die Zahl und Morphologie der Chromosomen einiger Pf lanzenarten aus dem Territorium der Ostslowakei I. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 181-227.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn75-78 — Na tarajan 1977
CCDB · book-ipcn75-78 — Dvorak & Dadakova 1975b
CCDB · book-ipcn75-78 — Dvorak & Dadakova 1975a
CCDB · book-ipcn75-78 — Zaborsky 1978
CCDB · book-ipcn75-78 — Natarajan 1978
+20 more references
n 73×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 720-747. Santa Brbara, C. & al.Lagascalia17(2): 367-379(1994).
CCDB · CromoCat 2015 — Santa Bárbara, C., J. Vioque, R. Juan, J. Pastor & J. C. Diosdado. (1994). Números cromosómicos para la flora española. 720-747. Lagascalia 17(2): 367-379.
CCDB · CromoCat 2015 — Senn, H. A. (1938b). Chromosome number relationships in the Leguminosae. Bibliogr. Genet. 12: 175-345.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type99 167 records
Wild obs. + sensor94 790
Museum / vouchered3 748
Cultivated / captive48
Other581
Origin
Native501
Introduced3 430
Range
Area of Occupancy AOO154 836 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 32 390≤1 km 9 680≤10 km 38 457>10 km 1 035
81 562 georeferenced · 13 228 without coordinates
Open the mapobservation + sensor94 790
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 390≤1 km 758≤10 km 781>10 km 73
2 002 georeferenced · 1 746 without coordinates
Open the institutions mapphysical evidence3 748
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5>10 km 5
10 georeferenced · 38 without coordinates
Open the mapnot free-living48
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions192 of 307 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 296 |
| BRNUlocation not on record | 249 |
| SLU Artdatabankenlocation not on record | 115 |
| LDlocation not on record | 100 |
| Philadelphia, US | 98 |
| Chongqing Museumlocation not on record | 94 |
| MAlocation not on record | 91 |
| València, ES | 80 |
| Allentown, US | 71 |
| BDBClocation not on record | 71 |
| Barcelona, ES | 65 |
| MeiseBGlocation not on record | 63 |
| DBF-NHMDlocation not on record | 51 |
| BClocation not on record | 41 |
| GJOlocation not on record | 41 |
| Museo Entomologico de Leonlocation not on record | 40 |
| Bronx, US | 37 |
| Bangkok, TH | 35 |
| WTUlocation not on record | 34 |
| Canberra, AU | 33 |
| Claremont, US | 33 |
| Riverside, US | 33 |
| Entomological Society of Latvialocation not on record | 33 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 31 |
| Auckland, NZ | 31 |
| College of the Atlantic, Museumlocation not on record | 29 |
| Pullman, US | 28 |
| Olocation not on record | 28 |
| Ann Arbor, US | 25 |
| Görlitz, DE | 25 |
| Berlin, DE | 25 |
| Badajoz, ES | 25 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 25 |
| Salamanca, ES | 24 |
| Spearfish, US | 24 |
| Provincia di Livornolocation not on record | 23 |
| Adelaide, AU | 23 |
| CICYTEXlocation not on record | 22 |
| Christchurch, NZ | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| Williamsburg, US | 22 |
| BFLlocation not on record | 21 |
| Corvallis, US | 21 |
| New Haven, US | 21 |
| ISAlocation not on record | 20 |
| University of Stellenboschlocation not on record | 20 |
| Mount Annan, AU | 20 |
| Davis, US | 19 |
| Adam Mickiewicz University in Poznańlocation not on record | 18 |
| Saint Louis, US | 18 |
| Montréal, CA | 18 |
| Québec, CA | 18 |
| San Sebastián, ES | 18 |
| Wellington, NZ | 17 |
| San Diego, US | 16 |
| Portland, US | 16 |
| Madison, US | 16 |
| Burlington, US | 15 |
| CJBGlocation not on record | 15 |
| College Park, US | 15 |
| San Luis Obispo, US | 15 |
| Denver, US | 15 |
| Vitoria, ES | 15 |
| Bloomington, US | 15 |
| Victoria, CA | 15 |
| Santa Barbara, US | 14 |
| Angwin, US | 14 |
| Wuzhou, CN | 14 |
| Arcata, US | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| Oskarshamn, SE | 13 |
| Millersville, US | 13 |
| Hobart, AU | 13 |
| Salzburg, AT | 13 |
| South Kensington, GB | 12 |
| Wlocation not on record | 12 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Brisbane, AU | 11 |
| Flagstaff, US | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Karlsruhe, DE | 10 |
| Rotorua, NZ | 10 |
| KFGBlocation not on record | 10 |
| Green Bay, US | 10 |
| Brussel, BE | 10 |
| KMNlocation not on record | 10 |
| Santiago de Compostela, ES | 10 |
| Mlocation not on record | 10 |
| Moscow, US | 10 |
| Pamplona, ES | 10 |
| Emporia, US | 9 |
| Madrid, ES | 9 |
| Moscow State Universitylocation not on record | 9 |
| Córdoba, ES | 9 |
| Provo, US | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| Pamplona, ES | 9 |
| Granada, ES | 8 |
| Acadia Universitylocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| Tuscaloosa, US | 8 |
| Albuquerque, US | 8 |
| EL PASO, US | 7 |
| University of New Hampshirelocation not on record | 7 |
| Odawara, JP | 7 |
| Dekalb, US | 7 |
| FRA243location not on record | 7 |
| IDElocation not on record | 7 |
| CASlocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Tacoma, US | 6 |
| Saint John, CA | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Norfolk, US | 6 |
| Bern, CH | 6 |
| Fayetteville, US | 6 |
| Bando, JP | 6 |
| St. Paul, US | 6 |
| ASUlocation not on record | 6 |
| Uppsala, SE | 6 |
| Toronto, CA | 5 |
| Tartu, EE | 5 |
| Columbia, US | 5 |
| Hudson, US | 5 |
| Tsukuba, JP | 5 |
| Bourges, FR | 5 |
| Alicante, ES | 5 |
| Morgantown, US | 5 |
| Université Lavallocation not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| Northridge, US | 5 |
| Monastir, TN | 5 |
| Kensington, AU | 5 |
| Porrentruy, CH | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| San Angelo, US | 5 |
| Uniwersytet Wrocławskilocation not on record | 5 |
| Durango, US | 4 |
| Córdoba, AR | 4 |
| Armidale, AU | 4 |
| Austin, US | 4 |
| Dover, US | 4 |
| Honolulu, US | 4 |
| Jaén, ES | 4 |
| Zürich, CH | 4 |
| OLAlocation not on record | 4 |
| Vancouver, CA | 4 |
| Turlock, US | 4 |
| PRClocation not on record | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Johnson City, US | 4 |
| Bozeman, US | 4 |
| Paris, FR | 4 |
| Boise, US | 4 |
| Namur, BE | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Corrientes, AR | 3 |
| Jackson, US | 3 |
| BISHlocation not on record | 3 |
| New Brunswick, US | 3 |
| Winterthur, CH | 3 |
| Chapel Hill, US | 3 |
| Orem, US | 3 |
| Beijing, CN | 3 |
| Nagano City, JP | 3 |
| Pacific Lutheran Universitylocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Shinshu Universitylocation not on record | 3 |
| BSBIlocation not on record | 3 |
| Phoenix, US | 3 |
| QVMAGlocation not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Kew, GB | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Logan, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Missoula, US | 3 |
| Zürich, CH | 3 |
| Fort Worth, US | 3 |
| Whitewater, US | 3 |
| Chadron, US | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| LfUlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Knoxville, US | 2 |
| Santa Cruz, US | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Hamilton, US | 2 |
| San Jose, US | 2 |
| Fulda, DE | 2 |
| Walla Walla, US | 2 |
| Tampa, US | 2 |
| GAlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Cape Town, ZA | 2 |
| Ashland, US | 2 |
| UIBlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Davenport, US | 2 |
| Cape Town, ZA | 2 |
| Chapingo, MX | 2 |
| Porto Alegre, BR | 2 |
| Pittsburg, US | 2 |
| Lincoln, US | 2 |
| San Isidro, AR | 2 |
| Little Rock, US | 2 |
| Irvine, US | 2 |
| Mexico City, MX | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Fairfax, US | 2 |
| AUAlocation not on record | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Tilburg, NL | 2 |
| Philadelphia, US | 2 |
| Springfield, US | 2 |
| GB | 2 |
| Jefferson City, US | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Fredericksburg, US | 2 |
| San Francisco, US | 2 |
| Cambridge, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| STNFlocation not on record | 1 |
| MMHNSRlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Taipei, TW | 1 |
| Sendai, JP | 1 |
| UMKClocation not on record | 1 |
| Mérida, MX | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Sion, CH | 1 |
| Kirksville, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| LINUlocation not on record | 1 |
| Due West, US | 1 |
| Denton, US | 1 |
| PrivatHerblocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Tallinn, EE | 1 |
| Richmond, US | 1 |
| KNFYlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| San Bernardino, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Lausanne, CH | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Clemson, US | 1 |
| University of Genevalocation not on record | 1 |
| Durango, MX | 1 |
| H-Schuhwlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| ESP003location not on record | 1 |
| Helsinki, FI | 1 |
| Fukushima Universitylocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Sapporo, JP | 1 |
| BAYLUlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Minia, EG | 1 |
| Coimbra, PT | 1 |
| Macomb, US | 1 |
| H-Dunkellocation not on record | 1 |
| US | 1 |
| Dresden, DE | 1 |
| Montecillo, Texcoco, MX | 1 |
| Podgorica, ME | 1 |
| Nijmegen, NL | 1 |
| Edmonton, CA | 1 |
| H-Adlerlocation not on record | 1 |
| Otaru, JP | 1 |
| Los Angeles, US | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Washington, US | 1 |
| H-Hohlalocation not on record | 1 |
| Bend, US | 1 |
| nbflocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Durban, ZA | 1 |
| GZUlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Mississippi State, US | 1 |
| Sanda, JP | 1 |
| Banyoles, ES | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Parkville, AU | 1 |
| SZUlocation not on record | 1 |
| Bothell, US | 1 |
| Jiangxi Universitylocation not on record | 1 |
| Tomioka, JP | 1 |
| Long Beach, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Conway, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Henderson, US | 1 |
| Portland, US | 1 |
| Trondheim, NO | 1 |
| Kunming, CN | 1 |
307 institutions · 3 582 of 3 748 vouchered records shown · 165 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Lathyrus latifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys2
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map6 countries0
HedgerowThickets, former residential hedge rows.Side of road, dry loam, mostly sunny. Assoc.…Disturbed poor soil, on N side of shrubbery,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.2 °C 15.7–21.4
Seasonal swing summer↔winter21.1 °C
Max temp (day)23.5 °C 20.3–25.7
Min temp (night)14.5 °C 11.1–18.3
Precipitation75.4 mm/mo 45.5–92.3
Air humidity58.8 % 57.4–60.2
Moisture balance-44.0 mm/mo -91.2–-32.9
Vapour deficit928 Pa 783–1,035
Wind speed2.20 m/s 2.20–3.20
Cloud cover28.9 % 28.9–41.3
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.