Lasiacantha capucina

(Germar, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Tingidae/Lasiacantha

At a glance

Occurrence records316

Data sources8

Biological traits1

DNA specimens12

eDNA detections9

Sources8 archives

Databases and archives Lasiacantha capucina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF316 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Lasiacantha capucina is a species of true bug belonging to the family Tingidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lasiacantha capucina has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections9

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

223Cmostly conserved

343Tmostly conserved

415Amostly conserved

459Tmostly conserved

TACATTATACTTCATCTTTGGTATATGAGCAGGAATATTAGGAACATCAATAAGATGAATTATCCGAATTGAACTAAGTCAATCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dictyla nassatasame family14.8%Tingis reticulatasame family15.7%Tingis ampliatasame family15.8%Derephysia foliaceasame family16.3%Physatocheila costatasame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type316 records

Wild obs. + sensor171

Museum / vouchered46

Cultivated / captive2

Other97

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 63≤1 km 16≤10 km 65>10 km 4

148 georeferenced · 23 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 12≤10 km 15

30 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence46

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
Philadelphia, US	3
CBDClocation not on record	2
Tartu, EE	1

5 institutions · 13 of 46 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Lasiacantha capucina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 12.4–18.8

Seasonal swing summer↔winter18.8 °C

Max temp (day)20.4 °C 17.0–23.2

Min temp (night)11.4 °C 8.10–13.8

Precipitation83.9 mm/mo 67.9–109

Air humidity58.4 % 57.5–60.9

Moisture balance-24.4 mm/mo -62.1–-5.30

Vapour deficit743 Pa 576–915

Wind speed3.10 m/s 2.70–3.40

Cloud cover36.8 % 34.5–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)