Lasaeola tristis

(Hahn, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Lasaeola

At a glance

Occurrence records832

Data sources8

Biological traits15

DNA specimens19

eDNA detections38

Sources8 archives

Databases and archives Lasaeola tristis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility832 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

World Spider Trait DBMasaryk University15 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources15 traits

Occurrence & distributionGBIF832 records

Environmental DNA3 datasets · 6 countries38 detections

DNA & barcodingBOLD19 specimens

01Narrative

Lasaeola tristis is a tangle web spider species found from Europe to Central Asia. It is notably found in Lithuania.The checklist of Lithuanian spiders (Arachnida: Araneae). Marija Biteniekytė and Vygandas Rėlys, Biologija, 2011, Vol. 57, No. 4, pages 148–158,

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Staręga et al. 2001SLU 2020Henriksen & Hilmo 2015Bruun & Lissner 2019Hyvärinen et al. 2019Harvey et al. 2017Komposch & Steinberger 1999Maelfait et al. 1998Řezáč et al. 2015Nährig et al. 2003Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Blick et al. 2016Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀2.95·♂1.79 mm

Cephalothorax height♀0.46·♂0.4 mm

Cephalothorax length♀1.04·♂0.77 mm

Cephalothorax width♀0.83·♂0.67 mm

Fang length♀0.1·♂0.1 mm

Tibia I length♀0.47·♂0.51 mm

Predation1

Hunting guildspace web weavers

Ecology8

Circadian activity0.69 mm

Light0.625 mm

Light 2partly shaded

Moisture 10.5 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryNear Threatened (V)

Stratum0.79 mm

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lasaeola tristis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes2

eDNA detections38

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

34Gmostly conserved

46Tmostly conserved

58Gmostly conserved

232Tmostly conserved

265Gmostly conserved

271Tvariable

343Tmostly conserved

352Gmostly conserved

364Avariable

487Tvariable

625Amostly conserved

628Amostly conserved

TACATTGTATTTTTTATTTGGAATTTGATCAGCGATATTAGGTACTGCAATAAGAGTGTTAATTCGAATTGAATTAGGGCAGCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes8

BIN1

Most divergent pair0.61%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dipoena nigrasame family8.8%Dipoena braccatasame family9.4%Dipoena malkinisame family10.5%Parasteatoda nigrovittatasame family10.7%Dipoena melanogastersame family10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type832 records

Wild obs. + sensor463

Museum / vouchered292

Other77

Origin

Native5

Range

Area of Occupancy AOO1 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 157≤1 km 105≤10 km 122

384 georeferenced · 79 without coordinates

Open the mapobservation + sensor463

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 26≤1 km 24≤10 km 60>10 km 5

115 georeferenced · 177 without coordinates

Open the institutions mapphysical evidence292

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	100
Adam Mickiewicz University in Poznańlocation not on record	22
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	14
SLU Artdatabankenlocation not on record	13
Ekaterinburg, RU	8
Bonn, DE	7
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Tartu, EE	5
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	5
Uniwersytet w Białymstokulocation not on record	4
neflocation not on record	3
SGAV-and-NHMDlocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Tilburg, NL	2
MZLUlocation not on record	2
Frankfurt am Main	2
Rovaniemi, FI	1
Akademia Pomorska w Słupskulocation not on record	1
Metsähallituslocation not on record	1
Denver, US	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
	1

22 institutions · 202 of 292 vouchered records shown · 90 without an institution code

09Environmental DNA38 detections

Where the DNA of Lasaeola tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys3

Countries6

Verifiable raw sequence linked18

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

Wiese, auf KieferzweigenBinnendÃ¼ne, Sandtrockenrasen, SukzessionswaldHeide, auf Eichenzweigen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 8.10–16.2

Seasonal swing summer↔winter22.9 °C

Max temp (day)16.8 °C 12.1–20.0

Min temp (night)8.70 °C 4.70–12.0

Precipitation70.3 mm/mo 48.3–97.1

Air humidity58.8 % 56.1–62.3

Moisture balance-18.1 mm/mo -56.0–27.5

Vapour deficit617 Pa 461–760

Wind speed2.60 m/s 2.10–4.10

Cloud cover46.4 % 35.5–55.7

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)