Lamprogrammus brunswigi

(Brauer, 1906) · species

image placeholder — illustration coming later

Animalia/Chordata/Ophidiiformes/Ophidiidae/Lamprogrammus

At a glance

Occurrence records69

Data sources9

Biological traits7

DNA specimens13

eDNA detections13

Sources9 archives

Databases and archives Lamprogrammus brunswigi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

OBISOcean Biodiversity Information System22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS69 records

Environmental DNA1 datasets · 5 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Lamprogrammus brunswigi is a species of fish in the family Ophidiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length90 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 600 m

Depth min800 m

Vulnerability56

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lamprogrammus brunswigi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

1Tmostly conserved

2Tmostly conserved

17Amostly conserved

89Gmostly conserved

92Cmostly conserved

116Tvariable

125Gmostly conserved

131Tmostly conserved

140Tmostly conserved

200Amostly conserved

221Avariable

227Avariable

236Gmostly conserved

281Avariable

341Gmostly conserved

350Amostly conserved

356Gvariable

365Tvariable

425Avariable

428Amostly conserved

440Amostly conserved

473Amostly conserved

611Tvariable

665Amostly conserved

TTGGCACCCTTTATCTAGTATTTGGTGCTTGGGCCGGAATGGTCGGGACAGCCTTAAGTCTGCTAATTCGAGCAGAACTAAGCCAACCGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes8

BIN1

Most divergent pair2.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lamprogrammus nigersame genus9.5%Lamprogrammus exutussame genus11.0%Hiodon alosoidessame order16.8%Dicrolene longimanasame family16.9%Epinephelus morrhuasame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor8

Museum / vouchered59

Other2

Origin

Native1

Range

Area of Occupancy AOO116 km²

Depth

0–200 m sunlit0

200–1000 m twilight2

1–4 km midnight8

>4 km abyssal0

median 1 114.5 m · max 1 345 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 3≤1 km 26≤10 km 1>10 km 2

32 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	26
Washington, US	4
Museums Victorialocation not on record	2
FishBaselocation not on record	2
Cambridge, US	2
Wuzhou, CN	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Los Angeles, US	1
Copenhagen, DK	1

9 institutions · 40 of 59 vouchered records shown · 3 without an institution code

09Environmental DNA13 detections

Where the DNA of Lamprogrammus brunswigi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 7.90–25.9

Seasonal swing summer↔winter2.10 °C

Max temp (day)26.1 °C 10.1–26.4

Min temp (night)25.1 °C 6.10–25.2

Precipitation87.4 mm/mo 35.3–136

Air humidity60.8 % 59.2–64.6

Vapour deficit1,292 Pa 433–1,304

Cloud cover45.1 % 39.4–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)