Lamium bifidum

Cirillo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Lamium

At a glance

Occurrence records888

Data sources9

Biological traits10

DNA specimens8

eDNA detections5

Sources9 archives

Databases and archives Lamium bifidum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility888 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF888 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Lamium bifidum is a species of flowering plant in the mint family Lamiaceae, native to the Southern Europe. It was first described by botanist Domenico Cirillo in 1788.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lamium bifidum has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKF055051.1 ↗679 bpFrance · 1990

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAGCAGACCGCGAACACGTTCAAAACAACACCGGGGCCCCGGAGGTGGGG …

Lamium bifidum isolate 284 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lamium bifidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

CCDB · iber-fl — Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.VI Jorn. Fitosoc. Veg. Barcelona66(1986).

CCDB · iber-fl — Consideraciones cariolgicas sobre algunas especies nitrfilas de Lamium L. Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Acta Bot. Barcinon.37: 149-154(1989).

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 551-555. Ortega Olivencia, A. & T. Ruz Tllez.Anales Jard. Bot. Madrid47(1): 175-177(1990).

CCDB · ipcn-api-dl — Elena Rosselló, J. A., M. A. G. Zapatero & F. N. Andrés. 1989. Consideraciones cariológicas sobre algunas especies nitrofilas de Lamium L. Acta Bot. Barcinon. 37: 149–154.

CCDB · ipcn-api-dl — Ortega Olivencia, A. & T. R. Téllez. 1990. Números cromosomáticos de plantas occidentales, 551--555. Anales Jard. Bot. Madrid 47: 175–177.

CCDB · book-fedorov — Bernstrom 1955

CCDB · Cave1956supp — Bernstrom 1955

n 93×CCDB · iber-fl · CCDB · ipcn-api-dl

CCDB · iber-fl — Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.VI Jorn. Fitosoc. Veg. Barcelona66(1986).

CCDB · iber-fl — Consideraciones cariolgicas sobre algunas especies nitrfilas de Lamium L. Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Acta Bot. Barcinon.37: 149-154(1989).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type888 records

Wild obs. + sensor771

Museum / vouchered117

Range

Area of Occupancy AOO2 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 320≤1 km 92≤10 km 184>10 km 13

609 georeferenced · 162 without coordinates

Open the mapobservation + sensor771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 2≤1 km 43≤10 km 7

52 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CICYTEXlocation not on record	37
LDlocation not on record	13
Institut und Museum fuer Geologie und Palaeontologielocation not on record	12
Salamanca, ES	11
Badajoz, ES	9
BIO-UNIPIlocation not on record	6
Barcelona, ES	3
Xiamen, CN	3
Wlocation not on record	3
ISAlocation not on record	2
BClocation not on record	2
College of the Atlantic, Museumlocation not on record	2
València, ES	2
Phyletisches Museum Jenalocation not on record	1
MAlocation not on record	1
Dresden, DE	1
GJOlocation not on record	1
CJBGlocation not on record	1
BRNUlocation not on record	1
Berlin, DE	1
Sevilla, ES	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

22 institutions · 114 of 117 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Lamium bifidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 11.6–14.2

Seasonal swing summer↔winter17.7 °C

Max temp (day)17.0 °C 15.5–18.5

Min temp (night)8.30 °C 7.50–9.10

Precipitation74.3 mm/mo 72.6–76.0

Air humidity60.4 % 58.7–62.1

Moisture balance-14.3 mm/mo -19.4–-9.30

Vapour deficit667 Pa 575–759

Wind speed3.60 m/s 2.80–4.40

Cloud cover41.4 % 41.0–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)