Lamium amplexicaule

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Lamium

At a glance

Occurrence records193 475

Data sources16

Biological traits62

DNA specimens46

eDNA detections30

Sources16 archives

Databases and archives Lamium amplexicaule's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility193 475 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources62 traits

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF193 475 records

Environmental DNA1 datasets · 8 countries30 detections

DNA & barcodingBOLD · NCBI46 specimens

Genome at a glanceCCDB · GIFT · GoaT665 Mbp

01Narrative

Lamium amplexicaule, commonly known as common henbit, or greater henbit, is a species of Lamium native to Europe, Asia and northern Africa. It is a low-growing annual plant growing to 10–25 cm tall, with soft, finely hairy stems. The leaves are opposite, rounded, 2–3 cm diameter, with a lobed margin. The flowers are pink to purple, 1.5–2 cm long. The specific name refers to the amplexicaul leaves (leaves grasping the stem).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology18

Fruit length3 mm

⚠ sources differ — AusTraits: 3 mm · GIFT: 2 mm

Leaf length13.5 mm

Leaf length max20 mm

Leaf length min7 mm

Leaf mass8.46 mg

Leaf size316 mm²

⚠ sources differ — TRY: 316 mm² · LEDA: 167 mm² · GIFT: 167 mm²

Leaf width17.5 mm

⚠ sources differ — AusTraits: 17.5 mm · GIFT: 13 mm

Leaf width max25 mm

Leaf width min7 mm

Petiole length3 cm

Plant height0.141 m

⚠ sources differ — GIFT: 0.141 m · AusTraits: 0.4 m · LEDA: 0.15 m · TRY: 0.203 m

Plant height generative0.2 m

Plant height max0.4 m

Plant height min0.04 m

Seed length2.75 mm

Seed mass0.573 mg

Seed mass max0.608 mg

Seed mass min0.491 mg

Life cycle & reproduction18

Deciduousnessdeciduous

Dispersal typehuman

⚠ sources differ — LEDA: agochor · GIFT: unspecialized

Flower colourpink

Flower length max20 mm

Flower length min13 mm

Flowering endJul

Flowering startApr

Flowering timennnnnnnnynnn

Life formannual or biennial

Life spanannual

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproduction asexualabsent

Seed number200

Self fertilizationpresent

Sex typehermaphrodite

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 300 m

Elevation min0 m

Epiphyteterrestrial

Fruit typemericarp

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf formelliptic

Leaf shapewidely_ovate

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry8

Leaf C:N ratio14.5 g/g

Leaf c429 mg/g

Leaf dry-matter content (LDMC)145 mg/g

⚠ sources differ — TRY: 145 mg/g · LEDA: 135 mg/g

Leaf n29.57 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Seed longevity index0.5

Specific leaf area (SLA)30.94 mm²/mg

⚠ sources differ — TRY: 30.94 mm²/mg · LEDA: 19.7 mm²/mg · GIFT: 19.7 mm²/mg

Other traits2

Diaspore typemericarp

Seeds per fruit101-1000

03Chemical composition51 compounds

Compounds documented for Lamium amplexicaule across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iridoids monoterpenoids24

Unsaturated fatty acids4

Cinnamic acids and derivatives2

Stigmastane steroids2

Flavonols2

Documented compounds51 total

Compound	Amount	Source
(1S,4aR,5R,7S,7aR)-4,7-dimethyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,5,6,7a-tetrahydrocyclopenta[c]pyran-4a,5,7-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(1S,4aR,5R,7R,7aR)-4a,5-dihydroxy-4,7-dimethyl-5,6,7,7a-tetrahydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(E,6S)-2,6-dimethyl-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoct-2-enoic acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
5-hydroxy-2-(4-hydroxyphenyl)-3-methoxy-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
6beta-Hydroxyipolamiide	present	LOTUS
8-Epikingiside	present	LOTUS
Asperuloside	present	LOTUS
Barlerin	present	LOTUS
beta-D-Glucopyranoside, 7-(acetyloxy)-1,4a,5,6,7,7a-hexahydro-4a-hydroxy-4,7-dimethylcyclopenta(c)pyran-1-yl, (1S-(1alpha,4aalpha,7alpha,7aalpha))-	present	LOTUS

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lamium amplexicaule has left across the world's sequence archives.

At a glance

DNA specimens46

Marker genes8

GenBank sequences10

eDNA detections30

Countries11

The DNA barcodea real sequence read deposited for this species

ITSPZ361187.1 ↗354 bpUnited Kingdom · 2021

ACGT

GGCAGAATCCCGTGAACCATGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG …

Lamium amplexicaule voucher EDNA21-0060759 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL1rbcLatrnL-FITS9ITS1ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GIFT · GoaT · NCBI

The complete instruction manual Lamium amplexicaule carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size665 040 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lamium amplexicaule0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode68records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1868×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +15

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.

CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)

CCDB · brit-fl — Squirrell, J. Watsonia : (1994)

CCDB · iber-fl — Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.VI Jorn. Fitosoc. Veg. Barcelona66(1986).

CCDB · iber-fl — Consideraciones cariolgicas sobre algunas especies nitrfilas de Lamium L. Elena Rossell, J. A., M. A. Gonzlez Zapatero & F. Navarro Andrs.Acta Bot. Barcinon.37: 149-154(1989).

CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).

CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).

CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).

CCDB · iber-fl — Contribution a l'tude citotaxonomique des spermatophyta du Portugal. XVIII. Lamiaceae Fernandes, A. & M. T. Leitao.Mem. Soc. Brot.27: 27-75(1985).

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3478

CCDB · fl-europaea — Polya, 1950

CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.

CCDB · book-ipcn65 — Strid 1965a

CCDB · ipcn-api-dl — Elena Rosselló, J. A., M. A. G. Zapatero & F. N. Andrés. 1989. Consideraciones cariológicas sobre algunas especies nitrofilas de Lamium L. Acta Bot. Barcinon. 37: 149–154.

CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.

CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.

CCDB · ipcn-api-dl — Aryavand, A. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.

CCDB · ipcn-api-dl — Miura, N., Y. Iwatsubo & N. Naruhashi. 2005. Chromosome numbers of five species of Lamium (Labiatae) in Japan. J. Phytogeogr. Taxon. 53: 197–201.

CCDB · ipcn-api-dl — Fernandes, A. & M. T. Leitão. 1984. Contribution à l'étude cytotaxinomique des Spermatophyta du Portugal XVIII---Lamiaceae. Mem. Soc. Brot. 27: 27–75.

CCDB · book-ipcn72 — FERAKOVA, V. 1972. Bemerkungen zur Flora der Umgebung der Stadt Hlohovec in der Slowakei III. Erganzungen. Acta Fae. Rerum Nat. Univ. Comenianae Bot. 20: 149-158.

CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.

CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.

CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.

CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.

CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.

CCDB · book-ipcn73-74 — MARKOVA, M.L., & N.T. THU. 1974. In IOPB chromosome number reports XLIII. Taxon 23: 193-196.

CCDB · book-indian_vol1 — Jorgensen, C.A. 1927a ; Tischler, G. 1927a, 1934 ; Heiser, C.B. & Whita- ker, T.W. 1948 ; USve, A. & L6ve, D. 1956b; Strid, A. }965 ; Gadella, T.W.J. & Kliphuis, E. 1966; Skalins- ka, M. et al. 1968; Majovsky, J. et al. 1970b ; Fernandes, A. & Queiros, M. 1970-1971 ; Dahlgren, R. et al. 1971 ; Ferakova, V. 1972 ; Morton, J.K. 1973 ; Markova, M.L. & Thu, N.T. 1974; Aryavand, A. 1977a; Brand, C.V.D. et al. 1979

CCDB · book-fedorov — Jorgensen 1927a

CCDB · book-fedorov — Tischler 1927a, 1934

CCDB · book-fedorov — Heiser, Whitaker 1948

CCDB · book-fedorov — Love A., LOve D. 1956h

CCDB · book-fedorov — Strid 1965a

CCDB · book-atlas-flowering-plants — Bernstrom 1944

CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.

+28 more references

2n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786

n 914×CCDB · iapt · CCDB · iber-fl · CCDB · ipcn-api-dl +1

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 551-555. Ortega Olivencia, A. & T. Ruz Tllez.Anales Jard. Bot. Madrid47(1): 175-177(1990).

CCDB · ipcn-api-dl — Gill, D. E. 1983. Within tree variation in fruit production and seed set in Capparis odoratissima Jacó in Costa Rica. Brenesia 21: 33–40.

CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.

CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & Y. S. Bedi. 1981. Cytological studies on woody Euphorbiaceae from North and Central India. New Bot. 8: 35–44.

CCDB · ipcn-api-dl — Hill, M. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 128.

CCDB · ipcn-api-dl — Ortega Olivencia, A. & T. R. Téllez. 1990. Números cromosomáticos de plantas occidentales, 551--555. Anales Jard. Bot. Madrid 47: 175–177.

CCDB · ipcn-api-dl — Saggoo, M. I. & S. S. Bir. 1986. Meiotic studies on some east Himalayan members of family Labiatae. J. Indian Bot. Soc. 65: 304–309.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.

CCDB · CromoCat 2015 — Gill, L. S. (1983a). Cytotaxonomic studies of the tribe Stachydae (Labiatae) in Canada. Willdenowia 13: 175-181.

CCDB · CromoCat 2015 — Hill, L. M. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIV]. Taxon 31(1): 128.

CCDB · CromoCat 2015 — Ortega Olivencia, A. & T. Ruíz Téllez. (1990b). Números cromosomáticos de plantas occidentales, 551-555. Anales Jard. Bot. Madrid 47(1): 175-177.

CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.2% BUSCO

07Deep time~1.14 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.14 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type193 475 records

Wild obs. + sensor179 618

Museum / vouchered13 329

Cultivated / captive19

Other509

Origin

Native2 472

Introduced5 132

Range

Area of Occupancy AOO368 872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 57 605≤1 km 20 624≤10 km 65 807>10 km 3 830

147 866 georeferenced · 31 752 without coordinates

Open the mapobservation + sensor179 618

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 1 173≤1 km 2 573≤10 km 3 210>10 km 332

7 288 georeferenced · 6 041 without coordinates

Open the institutions mapphysical evidence13 329

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 18

19 georeferenced

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions262 of 457 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	1 997
Berlin, DE	446
LDlocation not on record	363
BIO-UNIPIlocation not on record	341
Wuzhou, CN	312
BFLlocation not on record	285
Philadelphia, US	223
Moscow State Universitylocation not on record	217
Chapel Hill, US	210
Beijing, CN	170
Olocation not on record	147
SLU Artdatabankenlocation not on record	144
Odawara, JP	143
MAlocation not on record	129
Sanda, JP	126
Fort Worth, US	125
CICYTEXlocation not on record	116
Oskarshamn, SE	106
Pullman, US	104
València, ES	103
Yangling, CN	101
Bronx, US	101
MeiseBGlocation not on record	99
QAUlocation not on record	97
Riverside, US	95
Chongqing Museumlocation not on record	89
Uniwersytet Warszawskilocation not on record	87
ASUlocation not on record	86
Chiba, JP	83
San Diego, US	78
Kunming, CN	77
Oulu, FI	77
Saint Louis, US	76
Chengdu, CN	72
Bloomington, US	70
Kochi, JP	68
Turku, FI	67
College Park, US	65
Claremont, US	64
Provincia di Livornolocation not on record	63
Mount Annan, AU	61
Zürich, CH	61
Brisbane, AU	59
Austin, US	59
Nagano City, JP	58
GJOlocation not on record	57
Córdoba, ES	56
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	55
BAYLUlocation not on record	55
Adelaide, AU	55
Bern, CH	54
Emporia, US	54
Moscow, US	53
BClocation not on record	52
Bando, JP	51
College of the Atlantic, Museumlocation not on record	50
Barcelona, ES	48
Badajoz, ES	47
University of Stellenboschlocation not on record	47
Görlitz, DE	46
WTUlocation not on record	46
Tartu, EE	45
Shinshu Universitylocation not on record	44
Entomological Society of Latvialocation not on record	43
Nanjing, CN	42
Williamsburg, US	41
Toyama, JP	41
Trondheim, NO	41
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	41
Museo Entomologico de Leonlocation not on record	41
NSMKlocation not on record	41
Lubbock, US	40
Chengdu, CN	40
Bangkok, TH	40
Tokushima, JP	39
Uppsala, SE	38
Flagstaff, US	37
KMNlocation not on record	37
TUR-Alocation not on record	37
Santa Barbara, US	36
Phoenix, US	35
EL PASO, US	35
South Kensington, GB	35
Canadian Department of Agriculturelocation not on record	35
BDBClocation not on record	34
Davis, US	33
Canberra, AU	33
Turlock, US	32
UGentlocation not on record	32
DBF-NHMDlocation not on record	32
Madrid, ES	32
Zürich, CH	31
Philadelphia, US	31
Xining, CN	30
Pittsburg, US	30
Granada, ES	30
Corvallis, US	30
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	29
Tuscaloosa, US	29
Guangzhou, CN	29
Tampa, US	29
Allentown, US	29
BRNUlocation not on record	28
Burlington, US	28
Pretoria, ZA	27
Kawasaki Shi Tama Ku, JP	26
Mlocation not on record	26
Kew, GB	26
New Haven, US	25
San Luis Obispo, US	25
Chadron, US	24
Herbarium of the Department of Botany, University of Tokyolocation not on record	24
Millersville, US	24
Norfolk, US	23
Wuhan, CN	23
Wlocation not on record	23
Wuhan, CN	23
Tallinn, EE	22
Armidale, AU	22
Salamanca, ES	22
Tomioka, JP	22
Tsukuba, JP	21
Garðabær, IS	21
Christchurch, NZ	21
Vitoria, ES	20
Hiratsuka City Museumlocation not on record	19
Academy of Sciences of the Republic of Uzbekistanlocation not on record	19
Knoxville, US	19
Castelar, AR	19
US	19
Bergen, NO	18
Salzburg, AT	18
Nagatoro-machi, Chichibu-gun, JP	18
Jackson, US	18
Institut und Museum fuer Geologie und Palaeontologielocation not on record	18
JP	17
Jyväskylä, FI	17
Uniwersytet Śląski w Katowicachlocation not on record	17
Bozeman, US	17
Pamplona, ES	17
Natural History Museum Rotterdamlocation not on record	17
Madison, US	17
Córdoba, AR	17
Sagamihara, JP	16
KR	16
Cheney, US	16
Lanzhou, CN	16
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	16
National Institute of Biological Resourceslocation not on record	16
Dresden, DE	15
Phyletisches Museum Jenalocation not on record	15
Ann Arbor, US	15
Seoul, KR	15
Fayetteville, US	14
Denver, US	14
Texas Lutheran Universitylocation not on record	14
Helsinki, FI	14
Logan, US	14
KURAlocation not on record	13
GMBAlocation not on record	13
Alicante, ES	13
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	13
Valdosta State Universitylocation not on record	13
Auckland, NZ	13
Frankfurt am Main	13
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	12
Denton, US	12
San Angelo, US	12
Vancouver, CA	12
Boise, US	12
Mississippi State, US	12
Pamplona, ES	12
UIBlocation not on record	12
WNNUlocation not on record	12
Stephenville, US	12
Valparaiso, CL	12
GAlocation not on record	11
Arcata, US	11
University of Southern Mississippilocation not on record	11
Fukushima Universitylocation not on record	11
Severin-McDaniel Insect Collectionlocation not on record	11
TROMlocation not on record	11
Hermosillo, MX	11
GB	11
DOI/NPS, Colonial National Historical Parklocation not on record	11
Osaka, JP	10
Northridge, US	10
Sevilla, ES	10
IDElocation not on record	10
Angwin, US	10
Whitewater, US	10
Albuquerque, US	9
US	9
ISAlocation not on record	9
Kuopio, FI	9
Kagoshima, JP	9
Jena Microbial Resource Collectionlocation not on record	9
University of New Hampshirelocation not on record	9
Yunnan Universitylocation not on record	9
Hobart, AU	9
Hazara Universitylocation not on record	9
Québec, CA	9
Musee des Dinosaures d'Esperaza (Aude)location not on record	9
Tilburg, NL	9
Dekalb, US	9
Los Angeles, US	9
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	9
Jaén, ES	9
Porrentruy, CH	8
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	8
Walla Walla, US	8
Staten Island, US	8
Miami, US	8
LfUlocation not on record	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
UChlocation not on record	7
Korea National Arboretumlocation not on record	7
Guiyang, CN	7
McWane Science Centerlocation not on record	7
PRClocation not on record	7
Lord Fairfax Community Collegelocation not on record	7
Akita Prefectural Museumlocation not on record	7
Dover, US	7
Weber State Universitylocation not on record	7
San Jose State University, Museum of Birds and Mammalslocation not on record	7
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	7
CJBGlocation not on record	7
Portland, US	7
Karlsruhe, DE	7
Provo, US	6
Nishihara, JP	6
Chicago, US	6
Tacoma, US	6
	6
Université Lavallocation not on record	6
Pocatello, US	6
SZUlocation not on record	6
Guilin, CN	6
Clemson, US	6
China Agricultural Universitylocation not on record	6
AUAlocation not on record	6
Kyoto Universitylocation not on record	6
Forssa, FI	6
John T. Waterhouse Herbariumlocation not on record	5
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Taipei, TW	5
University of North Carolina at Pembrokelocation not on record	5
Henderson, US	5
KOMlocation not on record	5
Kensington, AU	5
Awka, NG	5
Sion, CH	5
Stockholm, SE	5
Caldwell, US	5
Uniwersytet Opolskilocation not on record	5
Santa Cruz, US	5
Columbia, US	5
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	5
Wellington, NZ	5
CASlocation not on record	5
Green Bay, US	5
Ishikawa Museum of Natural Historylocation not on record	5
Xinxiang, CN	5
Frauenfeld, CH	5
Porvoo, FI	5
Obihiro Centennial City Museumlocation not on record	5
Iwate Prefectural Museumlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Urumqi, CN	4
Irvine, US	4
Bend, US	4
Toyota city nature sanctuarylocation not on record	4
Parthenon Tama History Museumlocation not on record	4
Universidad de La Salle (La Salle)location not on record	4
Shenzhen, CN	4
Sendai, JP	4
Bourges, FR	4
Otaru, JP	4
Long Beach, US	4
San Isidro, AR	4
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	4
Baltimore, US	4
University of Alberta Museumslocation not on record	4
Fulda, DE	4
Universidad de Antioquia (UdeA)location not on record	4
Springfield, US	4
University of Tennessee at Chattanoogalocation not on record	3
National Museum Waleslocation not on record	3
J.F.Oberlin Universitylocation not on record	3
Kingston, US	3
KIWElocation not on record	3
Xian, CN	3
Xiamen, CN	3
Rishon Le Zion, IL	3
Victoria, CA	3
NMBU:MINAlocation not on record	3
Mexico City, MX	3
Kirksville, US	3
Elocation not on record	3
Taipei, TW	3
Morgantown, US	3
Adam Mickiewicz University in Poznańlocation not on record	3
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	3
Palmerston, AU	3
BSBIlocation not on record	3
New Brunswick, US	3
Banyoles, ES	3
Saint John, CA	3
Servico de Microbiologia e Imunologialocation not on record	3
Museo della Bonifica di San Donà di Piavelocation not on record	3
Nijmegen, NL	3
Conway, US	3
Finnish Museum of Natural Historylocation not on record	3
Omachi Alpine Museumlocation not on record	3
Fairfax, US	3
Istituto Agrario Castelnuovolocation not on record	3
Jiujiang Forestry Institutelocation not on record	3
PrivatHerblocation not on record	3
Ashland, US	2
Conway, US	2
Cambridge, US	2
USFSlocation not on record	2
Paris, FR	2
John May Museum of Natural Historylocation not on record	2
Chicago, US	2
IMMUlocation not on record	2
Beijing Normal Universitylocation not on record	2
Tall Timbers Research Stationlocation not on record	2
Weymouth Woods Sandhills Nature Preservelocation not on record	2
Whitehorse, CA	2
US	2
Tianjin Natural History Museumlocation not on record	2
DNSMlocation not on record	2
Zhejiang Universitylocation not on record	2
Richmond, US	2
OLAlocation not on record	2
FFPRIlocation not on record	2
St. Paul, US	2
H-Schuhwlocation not on record	2
TAIElocation not on record	2
Changsha, CN	2
Monastir, TN	2
Durango, MX	2
Acadia Universitylocation not on record	2
Mexico City, MX	2
Guiyang, CN	2
The University of Arizonalocation not on record	2
Mie Prefectural Museumlocation not on record	2
Jefferson City, US	2
Taipei, TW	2
Naturalis Biodiversity Centerlocation not on record	2
FLADlocation not on record	2
Tempe, US	2
JBSlocation not on record	2
Philadelphia, US	2
Little Rock, US	2
Orem, US	2
Minia, EG	2
Keene State Universitylocation not on record	2
Natural History Museum, Tribhuvan Universitylocation not on record	2
Namur, BE	2
Museum of the Rockieslocation not on record	2
Chicago, US	2
Nagasaki University - Fisherieslocation not on record	2
Göteborg, SE	2
Strecker Museum, Baylor Universitylocation not on record	2
Edmonton, CA	2
HUT Culture Collectionlocation not on record	1
Wollongong, AU	1
Ypsilanti, US	1
New Mexico Museum of Natural History and Sciencelocation not on record	1
nbflocation not on record	1
Due West, US	1
STNFlocation not on record	1
Washington, US	1
Nanchong, CN	1
CJBNlocation not on record	1
San Francisco, US	1
Royal Botanic Gardens, Kewlocation not on record	1
Research Collection of B. A. Bennettlocation not on record	1
Oswego, US	1
Smithsonian Institutionlocation not on record	1
Sant Julià de Lòria, AD	1
Baroda, IN	1
San Bernardino, US	1
Portland, US	1
EMTCMlocation not on record	1
Universiti Sains Malaysialocation not on record	1
Berea Collegelocation not on record	1
KNFSClocation not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Fredericksburg, US	1
EEZA-CSIClocation not on record	1
Conservatoire botanique national du Bassin parisienlocation not on record	1
Pomona Collegelocation not on record	1
Hudson, US	1
Spearfish, US	1
ULBF-AGRlocation not on record	1
Lima, PE	1
Iquitos, PE	1
Central China Normal Universitylocation not on record	1
Guiyang, CN	1
La Paz, BO	1
UMKClocation not on record	1
Nishihara, JP	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Missoula, US	1
Cape Town, ZA	1
Salvador, BR	1
Boumlocation not on record	1
Davenport, US	1
Musée des Confluenceslocation not on record	1
DOI/NPS, Grand Canyon National Parklocation not on record	1
Museo Achille Folettolocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Tulane Universitylocation not on record	1
H-Dunkellocation not on record	1
San Jose, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
Quito, EC	1
Tromso University Museumlocation not on record	1
Columbus State University Herbariumlocation not on record	1
QCNElocation not on record	1
Anchorage, US	1
Muséum Henri Lecoqlocation not on record	1
Qarshi Botanical Gardenlocation not on record	1
Parkville, AU	1
Asheville, US	1
UC Berkeley, Blue Oak Ranch Reservelocation not on record	1
UoB-IBlocation not on record	1
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	1
Meguro Parasitological Museumlocation not on record	1
University of Patraslocation not on record	1
Universidad de Nariño (UdeNar)location not on record	1
Henry Brockhouse Collectionlocation not on record	1
GZUlocation not on record	1
Cambridge, US	1
JBRJlocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
Peking Universitylocation not on record	1
Montréal, CA	1
KNFHClocation not on record	1
Tampere, FI	1
Gijón, ES	1
Toronto, CA	1
Grand Junction, US	1
BG-NMNHSlocation not on record	1
GNWPlocation not on record	1
Batemans Bay, AU	1
La Trobe Universitylocation not on record	1
Waverly, US	1
H-AkrKGlocation not on record	1
SEFlocation not on record	1
Macomb, US	1
Edinburgh, GB	1
Oiso Municipal Museumlocation not on record	1

457 institutions · 12 348 of 13 329 vouchered records shown · 934 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA30 detections

Where the DNA of Lamium amplexicaule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map8 countries0

lawn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 6.10–16.7

Seasonal swing summer↔winter16.9 °C

Max temp (day)16.2 °C 8.40–20.5

Min temp (night)9.00 °C 3.20–12.5

Precipitation75.2 mm/mo 46.3–110

Air humidity60.3 % 55.9–65.5

Moisture balance-28.0 mm/mo -65.4–57.8

Vapour deficit589 Pa 334–804

Wind speed2.90 m/s 2.20–4.80

Cloud cover46.2 % 34.9–53.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources16 archives

Size & morphology18

Life cycle & reproduction18

Diet & foraging2

Habitat & environment14

Physiology & chemistry8

Other traits2

Compound class profile5 classes

Documented compounds51 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type193 475 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions262 of 457 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type193 475 records