Lamium album
speciesAt a glance
Occurrence records453 719
Data sources14
Biological traits51
DNA specimens52
eDNA detections248
Sources14 archives
Databases and archives Lamium album's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility453 719 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI248 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics52 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Chemical compositionLOTUS · NPASS43 compounds
Occurrence & distributionGBIF453 719 records
Environmental DNA2 datasets · 11 countries248 detections
DNA & barcodingBOLD · NCBI52 specimens
Genome at a glanceCCDB · GoaT949 Mbp
01Narrative
Le lamier blanc ou ortie blanche, est une espèce de plantes à fleurs de la famille des Lamiaceae. C'est une plante herbacée originaire de l'ensemble de l'Europe et de l'Asie occidentale. Elle croît dans des habitats variés allant de la prairie aux régions boisées, généralement sur des sols humides. Malgré son nom vernaculaire d'« ortie blanche » ou d'« ortie morte », ce n'est pas une ortie véritable. Elle ne pique pas. Les fleurs blanches et la tige à section carrée permettent de la distinguer sans équivoque.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology16
Leaf length max60 mm
Leaf mass42.65 mg
Leaf size2 100 mm²
⚠ sources differ — TRY: 2 100 mm² · LEDA: 2 333 mm² · GIFT: 1 971 mm²
Leaf width35 mm
Leaf width max35 mm
Leaf width min35 mm
Plant height0.317 m
⚠ sources differ — GIFT: 0.317 m · LEDA: 0.35 m · TRY: 0.423 m
Plant height generative0.35 m
Plant height max1.4 m
Plant height min0.1 m
Seed length3 mm
⚠ sources differ — TRY: 3 mm · GIFT: 2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass1.66 mg
⚠ sources differ — TRY: 1.66 mg · LEDA: 1.4 mg · GIFT: 1.56 mg
Seed mass max1.8 mg
Seed mass min1.51 mg
Life cycle & reproduction13
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
Flowering endOct
Flowering startApr
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number114
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean2 300 m
Elevation min1 800 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcrop fields, forest edges, meadows: dry, shrubberies, steppe, stony places
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio14.1 g/g
Leaf c466 mg/g
Leaf dry-matter content (LDMC)181 mg/g
Leaf n36.99 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)36.08 mm²/mg
⚠ sources differ — TRY: 36.08 mm²/mg · LEDA: 33.95 mm²/mg · GIFT: 35.9 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationascending
03Chemical composition43 compounds
Compounds documented for Lamium album across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Iridoids monoterpenoids39
Flavonols6
Cinnamic acids and derivatives $ Phenylethanoids4
Unsaturated fatty acids4
Iridoids monoterpenoids $ Secoiridoid monoterpenoids2
Documented compounds43 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Genipin | present | LOTUS | |
| (3S,4S,4aS)-4-acetyl-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,4a,5,6-tetrahydro-3H-pyrano[3,4-c]pyran-8-one | present | LOTUS | |
| 2,4,4-trimethyl-3-[(3R)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]cyclohex-2-en-1-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 8-Epiloganic Acid | present | LOTUS | |
| 8-Epiloganin | present | LOTUS | |
| [(1R,3R,4S,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,23S,25R)-3,10,11-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] benzoate | present | NPASS | |
| [(2R,3R,4R,5R,6R)-4-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)oxan-3-yl] (Z)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | LOTUS | |
| Agnuside | present | LOTUS | |
| Astragalin | present | LOTUS |
05DNA & barcoding52 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lamium album has left across the world's sequence archives.
At a glance
DNA specimens52
Marker genes7
GenBank sequences10
eDNA detections248
Countries11
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGT …
Lamium album isolate D4 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Lamium album carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size948 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lamium album0.95 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records16–182n range18median18mode59records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1857×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3473
CCDB · fl-europaea — Polya, 1949
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · poland — ?ukowski W. and S?owi?ska T. 1979. Chromosome numbers of Angiosperms of North-Western Poland. Part 1. Fragm. Flor. Geobot. 25, 477-483.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Roy, S. C., S. Ghosh & A. Chatterjee. 1988. A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93–97.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Zukowski, W. & T. Slowinska. 1979. Chromosome numbers of angiosperms of Northwestern Poland. Fragm. Florist. Geobot. 25: 477–483.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Starodubtsev, V. N. 1985. Chromosome numbers in the representatives of some families from the Soviet Far East. Bot. Zhurn. SSSR 70(2): 275–277. (In Russian).
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1986. A contribution to the study of chromosome numbers and geographical distribution of some species of the family Lamiaceae in the Soviet far east. Bot. Zhurn. SSSR 71: 195–200.
CCDB · ipcn-api-dl — Rudyka, E. G. 1995. Chromosome numbers in vascular plants from the southern part of the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(2): 87–90.
CCDB · ipcn-api-dl — Nishikawa, T. 1981. Chromosome counts of flowering plants of Hokkaido (5). Rep. Taisetsuzan Inst. Sci. 16: 45–53.
CCDB · ipcn-api-dl — Miura, N., Y. Iwatsubo & N. Naruhashi. 2005. Chromosome numbers of five species of Lamium (Labiatae) in Japan. J. Phytogeogr. Taxon. 53: 197–201.
CCDB · book-ipcn66 — Sokolovskaya 1966
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
CCDB · book-ipcn67-71 — POGHOSIAN, A.J., S.G. NARINIAN, & V.E. VOSKANIAN. 1971. Data on the caryogeographical study of flora of the Aragatz massif. Biol. Zurn. Armenii 24: 11: 37-43.
CCDB · book-northern-plants — Turesson 1938, Ji\rgensen 1927.
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · book-ipcn73-74 — TANAKA, R. 1974. Organizational system of meiotic division and the development of reproductive cells in higher plants. The Cell 6: 22-25
CCDB · book-indian_vol1 — Heitz, E. 1926; J6rgensen, C.A. 1927a, Tischler, G. 1934 ; Rohweder, H. 1937 ; Turesson, G. 1938 ; Delay, C. 1947 ; P6Iya, L. 1949 ; L6ve, A. & L!Sve, D. 1956b ; Sorsa, V. 1962 ; Gadella, T.W.J. & Kliphuis, E. 1963 ; Skalinska, M. et a!. 1968 ; Pal. S. 1971 ; Poghosian, A.J. et al. 1971 ; Morton, J.K. 1973
CCDB · book-fedorov — Heitz 1926
CCDB · book-fedorov — Jorgensen 1927a
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Turesson 1938
CCDB · book-fedorov — Delay 1947
+17 more references
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Marchal, E. 1920
CCDB · book-fedorov — Marchal 1920
n 912×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — Gill, D. E. 1983. Within tree variation in fruit production and seed set in Capparis odoratissima Jacó in Costa Rica. Brenesia 21: 33–40.
CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.
CCDB · ipcn-api-dl — Bir, S. S. & M. I. S. Saggoo. 1984. Cytological studies on the family Labiatae from Gharwal Himalayas. In: G.S. Paliwal (editor), The Vegetational Wealth of the Himalayas. pp. 471–482.
CCDB · ipcn-api-dl — Gill, L. S. 1984. The incidence of polyploidy in the West-Himalayan Labiatae. Rev. Cytol. Biol. Vég., Bot. 7: 5–16.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & Y. S. Bedi. 1981. Cytological studies on woody Euphorbiaceae from North and Central India. New Bot. 8: 35–44.
CCDB · ipcn-api-dl — Roy, S. C., S. Ghosh & A. Chatterjee. 1988. A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93–97.
CCDB · ipcn-api-dl — Zukowski, W. & T. Slowinska. 1979. Chromosome numbers of angiosperms of Northwestern Poland. Fragm. Florist. Geobot. 25: 477–483.
CCDB · book-ipcn73-74 — TERASAKA, o., & R. TANAKA. 1974. Cytological studies on the nuclear differentiation in microspore division of some angiosperms. Bot. Mag. (Tokyo) 87: 209-217.
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Bir, S. S. & Saggoo, M. I. S. (1984). Cytological studies on the family Labiatae from Gharwal Himalayas. In: G.S. Paliwal (editor), The Vegetational Wealth of the Himalayas. NONE LISTED pp. 471-482.
CCDB · CromoCat 2015 — Gill, L. S. (1984). The incidence of polyploidy in the West-Himalayan Labiatae. Revue de Cytologie et de Biologie Végétales, le Botaniste 7: 5-16.
CCDB · CromoCat 2015 — Roy, S. C., S. Ghosh & A. Chatterjee. (1988). A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93-97.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type453 719 records
Wild obs. + sensor445 808
Museum / vouchered7 346
Cultivated / captive47
Other518
Origin
Native2 464
Introduced7 853
Range
Area of Occupancy AOO408 728 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 83 176≤1 km 97 770≤10 km 197 915>10 km 3 815
382 676 georeferenced · 63 132 without coordinates
Open the mapobservation + sensor445 808
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 353≤1 km 1 039≤10 km 2 521>10 km 202
4 115 georeferenced · 3 231 without coordinates
Open the institutions mapphysical evidence7 346
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 12
14 georeferenced · 33 without coordinates
Open the mapnot free-living47
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 216 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 733 |
| BFLlocation not on record | 486 |
| LDlocation not on record | 333 |
| Moscow State Universitylocation not on record | 276 |
| Olocation not on record | 187 |
| MeiseBGlocation not on record | 167 |
| Salzburg, AT | 165 |
| Oulu, FI | 158 |
| Uniwersytet Warszawskilocation not on record | 150 |
| Oskarshamn, SE | 142 |
| KMNlocation not on record | 142 |
| Bern, CH | 96 |
| Turku, FI | 95 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 91 |
| Beijing, CN | 79 |
| SLU Artdatabankenlocation not on record | 75 |
| Wlocation not on record | 61 |
| TUR-Alocation not on record | 60 |
| Jyväskylä, FI | 54 |
| Uniwersytet Opolskilocation not on record | 50 |
| Nanjing, CN | 50 |
| Görlitz, DE | 47 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 47 |
| Trondheim, NO | 46 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 44 |
| QAUlocation not on record | 42 |
| South Kensington, GB | 41 |
| Tartu, EE | 41 |
| Bergen, NO | 40 |
| Kuopio, FI | 40 |
| Uppsala, SE | 40 |
| Tallinn, EE | 37 |
| Uniwersytet Śląski w Katowicachlocation not on record | 34 |
| MAlocation not on record | 34 |
| UGentlocation not on record | 32 |
| BRNUlocation not on record | 32 |
| Garðabær, IS | 32 |
| Berlin, DE | 31 |
| Tula State Universitylocation not on record | 30 |
| Mlocation not on record | 30 |
| Porvoo, FI | 29 |
| Barcelona, ES | 27 |
| Provincia di Livornolocation not on record | 26 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 26 |
| BDBClocation not on record | 22 |
| Entomological Society of Latvialocation not on record | 21 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Helsinki, FI | 19 |
| Yangling, CN | 19 |
| Urumqi, CN | 19 |
| Guangzhou, CN | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Hazara Universitylocation not on record | 18 |
| Dresden, DE | 17 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| WNNUlocation not on record | 16 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 15 |
| Chengdu, CN | 14 |
| Karlsruhe, DE | 13 |
| GJOlocation not on record | 13 |
| Frankfurt am Main | 12 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 12 |
| València, ES | 12 |
| Philadelphia, US | 11 |
| Stockholm, SE | 11 |
| Xining, CN | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Salamanca, ES | 11 |
| 10 | |
| Otaru, JP | 10 |
| Winterthur, CH | 9 |
| Porrentruy, CH | 9 |
| Podgorica, ME | 9 |
| TROMlocation not on record | 9 |
| Paris, FR | 8 |
| Tilburg, NL | 8 |
| Urumqi, CN | 7 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Servico de Microbiologia e Imunologialocation not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Forssa, FI | 7 |
| BClocation not on record | 7 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 7 |
| ENTClocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| GZUlocation not on record | 6 |
| Zürich, CH | 6 |
| Inner Mongolia Universitylocation not on record | 6 |
| DBF-NHMDlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Edinburgh, GB | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| 东北师范大学自然博物馆location not on record | 5 |
| Frauenfeld, CH | 5 |
| Shanxi Institute of Biologylocation not on record | 5 |
| Universidad de La Salle (La Salle)location not on record | 5 |
| Vitoria, ES | 5 |
| University of New Hampshirelocation not on record | 5 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 5 |
| BSBIlocation not on record | 5 |
| Philadelphia, US | 5 |
| Guilin, CN | 5 |
| Bronx, US | 5 |
| Wuhan, CN | 4 |
| Sion, CH | 4 |
| Auckland, NZ | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Wuhan, CN | 4 |
| Xian, CN | 4 |
| SZUlocation not on record | 4 |
| Fulda, DE | 4 |
| Zhengzhou, CN | 4 |
| Bourges, FR | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Wellington, NZ | 4 |
| Wuzhou, CN | 3 |
| Flagstaff, US | 3 |
| Awka, NG | 3 |
| National Museum Waleslocation not on record | 3 |
| St. Paul, US | 3 |
| WTUlocation not on record | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 3 |
| Anchorage, US | 3 |
| Dehra Dun, IN | 3 |
| Granada, ES | 3 |
| UoB-IBlocation not on record | 3 |
| BGBMlocation not on record | 3 |
| Nanjing, CN | 3 |
| Madrid, ES | 3 |
| College Park, US | 3 |
| Hobart, AU | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Kew, GB | 3 |
| Ann Arbor, US | 3 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Taipei, TW | 2 |
| PrivatHerblocation not on record | 2 |
| Lausanne, CH | 2 |
| EL PASO, US | 2 |
| Whitehorse, CA | 2 |
| Canberra, AU | 2 |
| Chongqing Museumlocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Göteborg, SE | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Guizhou Forestry Schoollocation not on record | 2 |
| Davenport, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Columbia, US | 2 |
| Québec, CA | 2 |
| Dekalb, US | 2 |
| Kunming, CN | 2 |
| Rovaniemi, FI | 2 |
| Zürich, CH | 2 |
| Hangzhou, CN | 2 |
| Gijón, ES | 2 |
| Lanzhou, CN | 2 |
| Tuscaloosa, US | 1 |
| Saint Louis, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Xiamen, CN | 1 |
| Córdoba, ES | 1 |
| Bloomington, US | 1 |
| CICYTEXlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Badajoz, ES | 1 |
| ifplocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| nbflocation not on record | 1 |
| US | 1 |
| JBRJlocation not on record | 1 |
| Monastir, TN | 1 |
| Université Lavallocation not on record | 1 |
| AUT001location not on record | 1 |
| New Haven, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Denver, US | 1 |
| Mount Annan, AU | 1 |
| Pullman, US | 1 |
| Clemson, US | 1 |
| Ivano-Frankove, UA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Pamplona, ES | 1 |
| National Herbarium and Plant Laboratories, Nepallocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Seoul, KR | 1 |
| Fort Worth, US | 1 |
| Changsha, CN | 1 |
| Minia, EG | 1 |
| Durham, US | 1 |
| Moscow, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Logan, US | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Millersville, US | 1 |
| UnBlocation not on record | 1 |
| Allentown, US | 1 |
| Nijmegen, NL | 1 |
| Hamilton, US | 1 |
| Herb. BBGlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Alicante, ES | 1 |
| Banyoles, ES | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
216 institutions · 6 293 of 7 346 vouchered records shown · 515 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA248 detections
Where the DNA of Lamium album was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found248
Studies independent surveys2
Countries11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 248 detections have coordinates
Open the map11 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C 14.1–17.5
Seasonal swing summer↔winter22.7 °C
Max temp (day)21.2 °C 21.2–22.1
Min temp (night)12.0 °C 7.70–13.4
Precipitation77.3 mm/mo 12.0–77.3
Air humidity60.5 % 52.6–60.5
Moisture balance-38.2 mm/mo -75.0–-38.2
Vapour deficit761 Pa 761–790
Wind speed2.80 m/s 2.30–2.80
Cloud cover37.9 % 36.6–37.9
CHELSA 1981–2010, ~9 km grid, at location & month of 238 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.