Laelia albida

Bateman ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Laelia

At a glance

Occurrence records198

Data sources7

Biological traits6

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Laelia albida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility198 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF198 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaTgenome

01Narrative

Laelia albida is the most northerly-growing laelia in Mexico. This epiphytic orchid bears ten or more small (5 cm) pale pink flowers on a half-meter terminal inflorescence in late winter to early spring. It is cold-tolerant close to freezing in the winter and needs to be kept dry until new vegetative growth is seen in late spring. It seems to do much better mounted on cork or hardwood than potted. The diploid chromosome number of L. albida has been determined as 2n = 42 and as 2n = ~63.page 252. Leonardo P. Felix and Marcelo Guerra: "Variation in chromosome number and the basic number of subfamily Epidendroideae (Orchidaceae)" Botanical Journal of the Linnean Society 163(2010)234-278, The Linnean Society of London

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Laelia albida has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAY008574.1 ↗633 bp

ACGT

TCGAGACCGAAATATATCGAACGATTCGGAGAACTCGTGAATGCGCGGCGGCAGCTGGCGTCGCGGAACAGCCGTCCCGATCCTGGCCTC …

Laelia albida isolate MWC6407 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Laelia albida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type198 records

Wild obs. + sensor117

Museum / vouchered80

Cultivated / captive1

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 43≤1 km 27≤10 km 10>10 km 3

83 georeferenced · 34 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 51≤1 km 3≤10 km 3

57 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence80

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	30
Durango, MX	15
Ciudad de México, MX	8
Ciudad de México, MX	6
Saint Louis, US	3
Tlalnepantla, MX	2
Chapingo, MX	2
Giardini Botanici Hanburylocation not on record	2
South Kensington, GB	2
Chicago, US	1
Bronx, US	1
Tampa, US	1
MEXUlocation not on record	1
Austin, US	1
Tuxtla Gutiérrez, MX	1

15 institutions · 76 of 80 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)