Lactuca virosa
speciesAt a glance
Occurrence records46 866
Data sources13
Biological traits48
DNA specimens19
eDNA detections8
Sources13 archives
Databases and archives Lactuca virosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility46 866 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
NCBIUS National Library of Medicinegenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS · NPASS53 compounds
Occurrence & distributionGBIF46 866 records
Environmental DNA1 datasets · 3 countries8 detections
DNA & barcodingBOLD19 specimens
Genome at a glanceCCDB · GoaT · NCBI≈3.4 Gbp
01Narrative
La Laitue vireuse ou Laitue sauvage est une espèce de laitue à feuilles allongées et craquantes, indigeste à maturité, mesurant de 50 à 200 cm. La Laitue vireuse compte avec le pavot somnifère, la jusquiame ou encore le cannabis, parmi les plantes sédatives, analgésiques, antispasmodiques et psychotropes les plus illustres qui soient connues depuis l'Antiquité.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology17
Fruit length5 mm
Leaf length max165 mm
Leaf mass285 mg
Leaf size7 261 mm²
Leaf width115 mm
Leaf width max115 mm
Leaf width min115 mm
Plant height1.38 m
⚠ sources differ — GIFT: 1.38 m · LEDA: 0.853 m · TRY: 0.95 m
Plant height generative1.3 m
Plant height max2.8 m
Plant height min0.5 m
Seed length4.5 mm
Seed length max4.5 mm
Seed length min4.5 mm
Seed mass0.888 mg
Seed mass max1.17 mg
Seed mass min0.65 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life spanannual/biennial
⚠ sources differ — TRY: annual/biennial · LEDA: annuals · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 877
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)177 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)23.39 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Monocarpymonocarp
03Chemical composition53 compounds
Compounds documented for Lactuca virosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids23
Germacrane sesquiterpenoids6
Prenyl quinone meroterpenoids4
Fatty aldehydes3
Flavones2
Documented compounds53 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-alpha-Tocopherol | present | NPASS | |
| (2R)-2,3-Dihydroxypropyl 5-deoxy-5-(dimethylarsinyl)-beta-D-ribofuranoside | present | NPASS | |
| (2R)-2,8-Dimethyl-2-[(4S,8S)-4,8,12-trimethyltridecyl]-3,4-dihydrochromen-6-ol | present | NPASS | |
| (2S)-2,5,8-trimethyl-2-[(4S,8S)-4,8,12-trimethyltridecyl]-3,4-dihydrochromen-6-ol | present | NPASS | |
| (2S)-2,7,8-trimethyl-2-[(4S,8S)-4,8,12-trimethyltridecyl]-3,4-dihydrochromen-6-ol | present | NPASS | |
| (3aS,4R,9aR,9bS)-4-hydroxy-9-(hydroxymethyl)-6-methyl-3-methylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione | present | LOTUS | |
| (3aS,5R,6aR,8S,9aR,9bS)-5,8-dihydroxy-3,6,9-trimethylidene-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one | present | LOTUS | |
| (3aS,5R,6aR,8S,9aR,9bS)-5-hydroxy-3,6,9-trimethylidene-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one | present | LOTUS | |
| (3aS,6E,10Z,11aR)-6-methyl-3-methylidene-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,6Z,10E,11aR)-6-methyl-3-methylidene-10-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca virosa has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes6
eDNA detections8
Countries6
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P1 584 bp consensus3 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.
Diversity (π)0.00%
Haplotypes1
BINs0
ACGACAAATCCGGTCCGATGGCTGTTCTCCACTAACCACAAGGATATAGGGACTCTATATTTCATCTTTGGTGCCATTGCTGGAGTGATG …
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa★ITS★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Lactuca virosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈3 378 627 238 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Lactuca virosa3.38 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1847×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · brit-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — CHICHIRICC G., TAMMARO F. - 1982 (1980). Numeri cromosomici per la flora italiana:778-786.. Inform. Bot. Ital. , 12(3): 321-325.
CCDB · ita-fl — BRULLO S., PAVONE P., ZIZZA A. - 1979. Numeri cromosomici per la flora italiana:602-616.. Inform. Bot. Ital. , 11(2): 139-147.
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 290-296. Blanca Lpez, G. & M. Cueto Romero.Anales Jard. Bot. Madrid41(1): 185-189(1984).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 373-381. Fernndez, I., M. J. Dez & J. Pastor.Lagascalia13(2): 299-302(1985).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3913
CCDB · fl-europaea — Fernandes & Queiros
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Fernández, I., M. J. Díez & J. Pastor. 1985. Números 373-381, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 299–302.
CCDB · ipcn-api-dl — Blanca López, G. & M. C. Romero. 1984. Números cromosomáticos de plantas occidentales, 290--296. Anales Jard. Bot. Madrid 41: 185–189.
CCDB · ipcn-api-dl — Mejías, J. A. 1992. Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113–130.
CCDB · ipcn-api-dl — Koopman, W. J. M., J. H. D. Jong & I. M. d. Vries. 1993. Chromosome banding patterns in lettuce species (Lactuca sect. Lactuca, Compositae). Pl. Syst. Evol. 185: 249–257.
CCDB · ipcn-api-dl — Koopman, W. J. M. & J. H. D. Jong. 1996. A numerical analysis of karyotypes and DNA amounts in lettuce cultivars and species (Lactuca subsect. Lactuca, Compositae). Acta Bot. Neerl. 45(2): 211–222.
CCDB · ipcn-api-dl — Chichiricco, G. & F. Tammaro. 1980a. Numeri cromosomici per la Flora Italiana: 778-786. Inform. Bot. Ital. 12: 321–325.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Gemeinholzer. 2005. New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · book-ipcn72 — KLIPHUIS, E . & J.H. WIEFFERING. 1972. Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neer!. 21: 598-604.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · eflora
CCDB · book-atlas-flowering-plants — Thompson et al. '41
CCDB · kew — Doležalová I, Lebeda A, Janecek J, Cíhalíková J, Krístková E, Vránova O. 2002. Variation in chromosome numbers and nuclear DNA contents in genetic resources of Lactuca L. species (Asteraceae). Genetic Resources and Crop Evolution 49: 383-395.
CCDB · CromoCat 2015 — Gemeinholzer (2005). New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · CromoCat 2015 — Koopman, W. J. M. & Jong, J. H. D. (1996). A numerical analysis of karyotypes and DNA amounts in lettuce cultivars and species (Lactuca subsect. Lactuca, Compositae). Acta Bot. Neerl. 45(2): 211–222.
CCDB · CromoCat 2015 — Babcock, E. B., Stebbins, G. & Jenkins, J. A. (1937). Chromosomes and phylogeny in some genera of the Crepidinae. Cytologia Fujii Jub.: 188-210.
CCDB · CromoCat 2015 — Blanca López, G. & Cueto Romero, M. (1984). Números cromosomáticos de plantas occidentales, 290-296. Anales Jard. Bot. Madrid 41(1): 185-189.
CCDB · CromoCat 2015 — Brullo, S., Pavone, P. & Zizza, A. (1979a). Numeri cromosomici per la flora italiana: 602-616. Inf. Bot. Ital. 11: 139-147.
CCDB · CromoCat 2015 — Chichiricco, G. & Tammaro, F. (1980b). Numeri cromosomici per la flora Italiana (778-786). Inf. Bot. Ital. 12: 321-325.
CCDB · CromoCat 2015 — Dalgaard, V. (1986b). Chromosome numbers in flowering plants from Madeira. Willdenowia 16: 221-240.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Fernández, I., Díez, M. J. & Pastor, J. (1985). Números cromosómicos para la flora española, 373-381. Lagascalia 13(2): 299-302.
CCDB · CromoCat 2015 — Kliphuis, E. & Wieffering, J. H. (1972). Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neerl. 21: 598-604.
CCDB · CromoCat 2015 — Morton, J. K. (1977). A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211-223.
CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.
+2 more references
n 99×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 290-294. Gallego, M. J.Lagascalia12(1): 131-132(1983).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 353-362. Silvestre, S.Lagascalia12(2): 298-303(1984).
CCDB · ipcn-api-dl — Silvestre, S. 1984. Números 353-362, In Números cromosómicos para la flora expañola. 300-364. Lagascalia 12: 298–303.
CCDB · ipcn-api-dl — Gallego, M. J. 1983. Números 290-294, in Números cromosómicos para la flora española. 257-300. Lagascalia 12: 131–132.
CCDB · CromoCat 2015 — Gallego, M. J. (1983). Números cromosómicos para la flora española, 290-294. Lagascalia 12(1): 131-132.
CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
CCDB · CromoCat 2015 — Silvestre, S. (1984). Números cromosómicos para la flora española, 353-362. Lagascalia 12(2): 298-303.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gemeinholzer (2005). New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · CromoCat 2015 — Koopman, W. J. M. & Jong, J. H. D. (1996). A numerical analysis of karyotypes and DNA amounts in lettuce cultivars and species (Lactuca subsect. Lactuca, Compositae). Acta Bot. Neerl. 45(2): 211–222.
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type46 866 records
Wild obs. + sensor45 276
Museum / vouchered1 141
Cultivated / captive82
Fossil1
Other366
Origin
Native3 784
Introduced57
Range
Area of Occupancy AOO77 200 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 6 159≤1 km 4 179≤10 km 29 122>10 km 272
39 732 georeferenced · 5 544 without coordinates
Open the mapobservation + sensor45 276
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 41≤1 km 159≤10 km 153>10 km 9
362 georeferenced · 779 without coordinates
Open the institutions mapphysical evidence1 141
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 81 without coordinates
Open the mapnot free-living82
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions66 of 119 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 83 |
| South Kensington, GB | 58 |
| NLD037location not on record | 56 |
| Christchurch, NZ | 48 |
| UChlocation not on record | 36 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 33 |
| BDBClocation not on record | 32 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 28 |
| València, ES | 26 |
| CJBGlocation not on record | 26 |
| Vitoria, ES | 25 |
| MAlocation not on record | 24 |
| Auckland, NZ | 24 |
| Entomological Society of Latvialocation not on record | 23 |
| Bern, CH | 23 |
| GJOlocation not on record | 23 |
| BClocation not on record | 19 |
| Barcelona, ES | 19 |
| WTUlocation not on record | 15 |
| Rotorua, NZ | 14 |
| San Sebastián, ES | 14 |
| Wellington, NZ | 14 |
| BFLlocation not on record | 12 |
| Zürich, CH | 12 |
| Berlin, DE | 12 |
| CICYTEXlocation not on record | 11 |
| LDlocation not on record | 10 |
| Zürich, CH | 10 |
| Stockholm, SE | 10 |
| Mlocation not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Pamplona, ES | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 7 |
| Madrid, ES | 6 |
| Salamanca, ES | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Görlitz, DE | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Staten Island, US | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| Phyletisches Museum Jenalocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Riverside, US | 4 |
| San Luis Obispo, US | 4 |
| Bronx, US | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Oskarshamn, SE | 4 |
| Davis, US | 3 |
| Xiamen, CN | 3 |
| CASlocation not on record | 3 |
| Fulda, DE | 3 |
| Wlocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Gijón, ES | 3 |
| Saint Louis, US | 3 |
| Uniwersytet Wrocławskilocation not on record | 3 |
| Alicante, ES | 3 |
| Salvador, BR | 2 |
| PrivatHerblocation not on record | 2 |
| ISAlocation not on record | 2 |
| Pamplona, ES | 2 |
| Tilburg, NL | 2 |
| UGentlocation not on record | 2 |
| Jaén, ES | 2 |
| Kew, GB | 2 |
| QAUlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Blumenau, BR | 2 |
| Tartu, EE | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Sion, CH | 2 |
| Nijmegen, NL | 2 |
| Claremont, US | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Bloomington, US | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Santiago, CL | 2 |
| Porrentruy, CH | 1 |
| Granada, ES | 1 |
| Corrientes, AR | 1 |
| Palmerston North, NZ | 1 |
| H-Adlerlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| BRNUlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Hazara Universitylocation not on record | 1 |
| Frankfurt am Main | 1 |
| Davenport, US | 1 |
| San Diego, US | 1 |
| Dresden, DE | 1 |
| Santa Barbara, US | 1 |
| Adelaide, AU | 1 |
| JBSlocation not on record | 1 |
| GBR006location not on record | 1 |
| Sevilla, ES | 1 |
| Boise, US | 1 |
| DBF-NHMDlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Angwin, US | 1 |
| Uppsala, SE | 1 |
| Miami, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Denver, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Bourges, FR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| San Francisco, US | 1 |
| Göteborg, SE | 1 |
| Firenze, IT | 1 |
| Québec, CA | 1 |
| Valparaíso, CL | 1 |
| Viña del Mar, CL | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Moscow, US | 1 |
| BSBIlocation not on record | 1 |
119 institutions · 957 of 1 141 vouchered records shown · 181 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA8 detections
Where the DNA of Lactuca virosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map3 countries0
in mulch under a peach tree in backyard garden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 10.0–20.1
Seasonal swing summer↔winter13.2 °C
Max temp (day)15.7 °C 13.5–25.9
Min temp (night)8.90 °C 6.40–15.3
Precipitation65.5 mm/mo 20.9–69.6
Air humidity62.2 % 58.6–63.8
Moisture balance-28.2 mm/mo -133–-0.5
Vapour deficit578 Pa 484–998
Wind speed4.30 m/s 2.10–4.50
Cloud cover43.5 % 24.0–49.5
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.