Lactuca viminea
(L.) J.Presl & C.Presl · speciesAt a glance
Occurrence records10 004
Data sources9
Biological traits39
DNA specimens5
eDNA detections4
Sources9 archives
Databases and archives Lactuca viminea's data was compiled from.
GBIFGlobal Biodiversity Information Facility10 004 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources39 traits
Occurrence & distributionGBIF10 004 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB · GoaT1.5 Gbp
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology6
Fruit length max15 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · LEDA: 0.3 m · TRY: 0.567 m
Plant height generative0.45 m
Plant height max0.8 m
Plant height min0.15 m
Seed mass1.51 mg
⚠ sources differ — TRY: 1.51 mg · LEDA: 1.16 mg · GIFT: 1.16 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourred
Flowering endAug
Flowering startJun
Life formbiennial
Life spanSL
⚠ sources differ — TRY: SL · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation min400 m
Epiphyteterrestrial
Fruit colourblack
Fruit typeachene
Growth formherb
Habitat GIFTforest, mountains, steppe, stony places
Leaf formelliptic
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)204 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)18.05 mm²/mg
Other traits4
Diaspore typefruit
Leaf arrangementalternate
Plant support typefree-standing
Shoot orientationerect
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca viminea has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes4
GenBank sequences10
eDNA detections4
Countries3
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCTCCC …
Lactuca viminea voucher PLT.0456 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★trnL-F★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Lactuca viminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 492 428 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lactuca viminea1.49 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1847×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BRULLO S., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:464-483.. Inform. Bot. Ital. , 10(2): 248-264.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Letz R., Uhríková A. & Májovský J., 1999: Chromosome numbers of several interesting taxa of the flora of Slovakia. - Biologia (Bratislava) 54/1: 43-49.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 64-85. Queirs, M.Bol. Soc. Brot. ser. 256: 79-98(1983).
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · fl-europaea — Ferakova, 1968
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Letz, R., A. Uhríková & J. Májovský. 1999. Chromosome numbers of several interesting taxa of the flora of Slovakia. Biologia (Bratislava) 54: 43–49.
CCDB · ipcn-api-dl — Kuzmanova, B. & S. Georgieva. 1980. In Chromosome number reports LXIX. Taxon 29: 715.
CCDB · ipcn-api-dl — Gemeinholzer. 2005. New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Mejías, J. A. 1992. Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113–130.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.
CCDB · ipcn-api-dl — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. 1994. Notas cariolo|3gicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97–101.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-fedorov — Whitaker. Jagger 1939
CCDB · book-fedorov — Thompson R. C. pt. al. 1941
CCDB · book-atlas-flowering-plants — Babcock et al. 1937
CCDB · kew — Doležalová I, Lebeda A, Janecek J, Cíhalíková J, Krístková E, Vránova O. 2002. Variation in chromosome numbers and nuclear DNA contents in genetic resources of Lactuca L. species (Asteraceae). Genetic Resources and Crop Evolution 49: 383-395.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Gemeinholzer (2005). New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Queirós, M. (1983b). Números cromossómicos para a flora portuguesa, 64-85. Bol. Soc. Brot. 56: 79-98.
CCDB · CromoCat 2015 — Mejías, J. A. (1992). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1993a). Karyological study of Bulgarian Asteraceae. Vll. Fitologija 44: 16-31.
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 715.
CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
CCDB · CromoCat 2015 — Lippert, W. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten Ber. Bayer. Bot. Ges. 76: 85–110
CCDB · CromoCat 2015 — Lippert. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · CromoCat 2015 — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. (1994). Notas cariológicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97-101.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 912×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 353-362. Silvestre, S.Lagascalia12(2): 298-303(1984).
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Silvestre, S. 1984. Números 353-362, In Números cromosómicos para la flora expañola. 300-364. Lagascalia 12: 298–303.
CCDB · CromoCat 2015 — Silvestre, S. (1984). Números cromosómicos para la flora española, 353-362. Lagascalia 12(2): 298-303.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Gemeinholzer (2005). New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · CromoCat 2015 — Lippert. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · CromoCat 2015 — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. (1994). Notas cariológicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97-101.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type10 004 records
Wild obs. + sensor8 952
Museum / vouchered491
Cultivated / captive6
Other555
Origin
Native709
Introduced1
Range
Area of Occupancy AOO16 824 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy34% within 1 km
≤100 m 1 076≤1 km 1 331≤10 km 4 750>10 km 19
7 176 georeferenced · 1 776 without coordinates
Open the mapobservation + sensor8 952
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 25≤1 km 107≤10 km 90>10 km 4
226 georeferenced · 265 without coordinates
Open the institutions mapphysical evidence491
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 5 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions30 of 56 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BRNUlocation not on record | 59 |
| LDlocation not on record | 51 |
| València, ES | 37 |
| GJOlocation not on record | 36 |
| BDBClocation not on record | 30 |
| Berlin, DE | 27 |
| Zürich, CH | 21 |
| Barcelona, ES | 17 |
| MAlocation not on record | 17 |
| Wlocation not on record | 13 |
| Zürich, CH | 13 |
| CICYTEXlocation not on record | 12 |
| BClocation not on record | 12 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Görlitz, DE | 9 |
| Bern, CH | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Dresden, DE | 8 |
| San Sebastián, ES | 6 |
| Rishon Le Zion, IL | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Salamanca, ES | 6 |
| Paris, FR | 5 |
| Coimbra, PT | 5 |
| NLD037location not on record | 5 |
| Pamplona, ES | 5 |
| Sevilla, ES | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Badajoz, ES | 4 |
| Granada, ES | 3 |
| Provincia di Livornolocation not on record | 3 |
| JBSlocation not on record | 3 |
| Madrid, ES | 2 |
| PRClocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| CZE061location not on record | 2 |
| Oskarshamn, SE | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Porrentruy, CH | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Córdoba, ES | 1 |
| Sion, CH | 1 |
| Frankfurt am Main | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| GZUlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Monastir, TN | 1 |
| South Kensington, GB | 1 |
| Alicante, ES | 1 |
| Pamplona, ES | 1 |
| Phoenix, US | 1 |
| GB | 1 |
| Fribourg, CH | 1 |
| BFLlocation not on record | 1 |
56 institutions · 485 of 491 vouchered records shown · 4 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Lactuca viminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.30 °C 8.30–16.4
Seasonal swing summer↔winter17.7 °C
Max temp (day)11.9 °C 11.9–21.5
Min temp (night)4.60 °C 4.60–10.3
Precipitation58.1 mm/mo 49.0–58.1
Air humidity64.0 % 55.8–64.0
Moisture balance-4.10 mm/mo -88.6–-4.10
Vapour deficit449 Pa 449–879
Wind speed3.70 m/s 2.80–3.70
Cloud cover41.9 % 36.5–41.9
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.