Lactuca tenerrima

Pourr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Lactuca

At a glance

Occurrence records3 450

Data sources10

Biological traits8

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Lactuca tenerrima's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF3 450 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Lactuca tenerrima Pourr., 1788 è una specie di pianta angiosperma dicotiledone della famiglia delle Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.4 m

Life cycle & reproduction3

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Lifespan years2 years

Habitat & environment3

Climatesubtropical

Growth formherb

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)20.72 mm²/mg

03Chemical composition4 compounds

Compounds documented for Lactuca tenerrima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones2

Simple coumarins1

Flavonols1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Apigenin	present	LOTUS
Cichoriin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca tenerrima has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ228644.1 ↗249 bp

ACGT

TCGAACATTGCAAGGTAGAACGACCTGTGAACAAGTAACCACAACCGGGAGATAGGGAAATGGGCCTTGGACCTTCCCTTGAAACCTTAT …

Lactuca tenerrima DNA for internal transcribed spacer 1 (ITS1)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lactuca tenerrima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1612×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · kew +1

CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).

CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1993. Chromosome numbers of north African phanerograms. I. Fl. Medit. 3: 187–210.

CCDB · ipcn-api-dl — Mejías, J. A. 1992. Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113–130.

CCDB · ipcn-api-dl — Vogt, R. & C. Oberprieler. 1994. Chromosome numbers of North African phanerogams. IV. Candollea 49(2): 549–570.

CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.

CCDB · kew — Doležalová I, Lebeda A, Janecek J, Cíhalíková J, Krístková E, Vránova O. 2002. Variation in chromosome numbers and nuclear DNA contents in genetic resources of Lactuca L. species (Asteraceae). Genetic Resources and Crop Evolution 49: 383-395.

CCDB · CromoCat 2015 — Vogt, R. & C. Oberprieler (1994). Chromosome numbers of North African phanerogams. IV. Candollea 49(2): 549-570.

CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.

CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.

CCDB · CromoCat 2015 — Humphries, C. J., Murray, B. G., Bocquet, G. & Vasudevan, K. N. (1978). Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131(4): 391-404.

CCDB · CromoCat 2015 — Vogt, R. & C. Oberprieler (1993a). Chromosome numbers of North African phanerogams. I. Fl. Medit. 3: 187-210.

n 84×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 748-763. Ruz de Clavijo Jimnez, E.Lagascalia17(2): 379-388(1994).

CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.

CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1994). Números cromosómicos para la flora española. 748-763. Lagascalia 17(2): 379-388.

n 162×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 342-348. Ubera, J. L. & E. Ruz de Clavijo Jimnez.Lagascalia12(2): 294-296(1984).

CCDB · CromoCat 2015 — Ubera, J. L. & E. Ruíz de Clavijo Jiménez. (1984). Números cromosómicos para la flora española, 342-348. Lagascalia 12(2): 294-296.

n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Vogt, R. & C. Oberprieler (1994). Chromosome numbers of North African phanerogams. IV. Candollea 49(2): 549-570.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 450 records

Wild obs. + sensor2 540

Museum / vouchered449

Cultivated / captive3

Other458

Origin

Native654

Range

Area of Occupancy AOO6 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 210≤1 km 857≤10 km 809>10 km 12

1 888 georeferenced · 652 without coordinates

Open the mapobservation + sensor2 540

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 9≤1 km 135≤10 km 131

275 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence449

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
València, ES	79
BDBClocation not on record	54
Barcelona, ES	39
BClocation not on record	26
Entomological Society of Latvialocation not on record	23
MAlocation not on record	22
Granada, ES	20
Sevilla, ES	20
Vitoria, ES	18
Phyletisches Museum Jenalocation not on record	15
College of the Atlantic, Museumlocation not on record	14
Alicante, ES	13
Madrid, ES	10
Jaén, ES	9
Salamanca, ES	8
EEZA-CSIClocation not on record	8
Córdoba, ES	8
CICYTEXlocation not on record	8
San Sebastián, ES	6
Universidad del Pais Vasco (UPV/EHU)location not on record	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
University of Stellenboschlocation not on record	4
Gijón, ES	3
GJOlocation not on record	3
JBSlocation not on record	3
Badajoz, ES	2
Wlocation not on record	2
Kew, GB	2
UIBlocation not on record	2
Museo della Bonifica di San Donà di Piavelocation not on record	2
Bourges, FR	1
Canadian Department of Agriculturelocation not on record	1
IPE-CSIClocation not on record	1
Paris, FR	1
NLD037location not on record	1
Pamplona, ES	1
Görlitz, DE	1
Frankfurt am Main	1
Oskarshamn, SE	1
Coimbra, PT	1
Claremont, US	1

41 institutions · 443 of 449 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Lactuca tenerrima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lactuca tenerrima

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Habitat & environment3

Physiology & chemistry1

Compound class profile3 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 450 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 450 records