Lactuca serriola
speciesAt a glance
Occurrence records344 749
Data sources16
Biological traits79
DNA specimens78
eDNA detections96
Sources16 archives
Databases and archives Lactuca serriola's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility344 749 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI96 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics78 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources79 traits
Chemical compositionDukesPhytochem · FoodAtlas · LOTUS · NPASS152 compounds
Occurrence & distributionGBIF344 749 records
Environmental DNA3 datasets · 13 countries96 detections
DNA & barcodingBOLD · NCBI78 specimens
Genome at a glanceCCDB · GoaT · NCBI2.9 Gbp
01Narrative
Lactuca serriola, also called prickly lettuce, milk thistle (not to be confused with Silybum marianum, also called milk thistle), compass plant, and scarole, is an annual or biennial plant in the tribe Cichorieae within the family Asteraceae. It has a slightly fetid odor and is commonly considered a weed of orchards, roadsides and field crops. It is the closest wild relative of cultivated lettuce (Lactuca sativa L.). Lactuca serriola is known as the compass plant because in the sun the upper leaves twist round to hold their margins upright. Lactuca serriola is native to Europe, Asia, and north Africa, and has become naturalized elsewhere.Flora Italiana, Lactuca serriola L. includes photos, drawings, European distribution mapCabrera, A. L. 1978. Compositae. 10: 1–726. In A. L. Cabrera (ed.) Flora de la provincia de Jujuy. Instituto Nacional de Tecnología Agropecuaria, Buenos AiresAtlas of Living Australia
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 3.25 mm
Fruit length max4 mm
Fruit length min3 mm
Fruit width1 mm
Fruit width max1 mm
Fruit width min1 mm
Leaf length180 mm
⚠ sources differ — AusTraits: 180 mm · GIFT: 110 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf mass397 mg
Leaf mass per area42.29 g/m2
Leaf size5 993 mm²
Leaf width60 mm
⚠ sources differ — AusTraits: 60 mm · GIFT: 41.25 mm
Leaf width max70 mm
Leaf width min10 mm
Plant height0.742 m
⚠ sources differ — GIFT: 0.742 m · AusTraits: 2 m · LEDA: 0.675 m · TRY: 1.1 m
Plant height generative0.85 m
Plant height max2.5 m
Plant height min0.3 m
Seed length3.5 mm
⚠ sources differ — TRY: 3.5 mm · GIFT: 2.8 mm
Seed length max2.8 mm
Seed length min2.8 mm
Seed mass0.523 mg
⚠ sources differ — TRY: 0.523 mg · AusTraits: 0.58 mg · LEDA: 0.569 mg · GIFT: 0.526 mg
Seed mass max0.96 mg
Seed mass min0.2 mg
Seed volume0.51 mm³
Seed volume max0.51 mm³
Seed volume min0.51 mm³
Life cycle & reproduction19
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flowering endOct
Flowering startApr
Flowering timennnnnnnnynnn
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Seed number182 713
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation mean1 233 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formoblong
Leaf shapeoblanceolate oblong
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.0 g/g
Leaf c439 mg/g
Leaf dry-matter content (LDMC)188 mg/g
Leaf n29.33 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.35 mm²/mg
⚠ sources differ — TRY: 19.35 mm²/mg · LEDA: 16.59 mm²/mg · GIFT: 16.59 mm²/mg
Other traits6
Diaspore typefruit
Inflorescencepanicle
Leaf arrangementalternate
Monocarpymonocarp
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition152 compounds
Compounds documented for Lactuca serriola across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Flavonols19
Guaiane sesquiterpenoids19
Cinnamic acids and derivatives18
Germacrane sesquiterpenoids8
Flavones5
Documented compounds152 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 352,000 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 204,160 ppm | DukesPhytochem | |
| OLEIC-ACID | 130,170 ppm | DukesPhytochem | |
| PALMITIC-ACID | 52,800 ppm | DukesPhytochem | |
| STEARIC-ACID | 13,165 ppm | DukesPhytochem | |
| CAPROIC-ACID | 7,392 ppm | DukesPhytochem | |
| ARACHIDIC-ACID | 1,091 ppm | DukesPhytochem | |
| folic acids | 0.058 mg/100g | FoodAtlas | |
| folates | 0.058 mg/100g | FoodAtlas | |
| folic acid | 0.058 mg/100g | FoodAtlas |
05DNA & barcoding78 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca serriola has left across the world's sequence archives.
At a glance
DNA specimens78
Marker genes10
GenBank sequences10
eDNA detections96
Countries14
The DNA barcodea real sequence read deposited for this species
TCGAACCCTGCAAGGCAGAACGACCCGTGAACATGTAACCACAACGGGGTGACCGTGATAAGGGCCTCGGTCCTTATCCCCTAACCCTTC …
Lactuca serriola voucher 4926 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_042378 ↗ · 37 protein · 25 tRNA · 6 rRNA
nad2nad5nad1cox2nad6rps12nad3matRccmFccobnad4mttBrps3rpl16atp1RNAPnad7ccmFnatp6rpl10ccmBrps4atp8cox3atp9cox1+9
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Lactuca serriola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 865 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lactuca serriola2.87 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode92records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1892×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +17
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — BRULLO S., PAVONE P., ZIZZA A. - 1979. Numeri cromosomici per la flora italiana:602-616.. Inform. Bot. Ital. , 11(2): 139-147.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Králik E. & Hrozienčik I., 2000: Karyologické štúdium slovenskej flóry XXXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 43-46.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1977a: Contribution to the karyological study of the species of Slovakian flora. - Biologia (Bratislava) 32/4: 243-254.
CCDB · slov-fl — Feráková V., 1971a: Príspevok k taxonómii rodu Lactuca L., pp. 353-365. - In: Magic D. (ed.), Zborník prednášok zo zjazdu SBS (Tisovec 5.-11. júl 1970). Časť II. SBS pri SAV, Bratislava.
CCDB · slov-fl — Feráková V., 2007: [New records in Artemisia, Chorispora, Crepis, Erucastrum, Fallopia, Helianthus, Lactuca, and Persicaria], pp. 111, 193, 214, 243, 258, 302, 354, 430. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. Watsonia 10: 159-161 (1974)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 197-200. Gallego, M. J.Lagascalia10(2): 231(1981).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3911
CCDB · fl-europaea — Polya, 1950
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · ipcn-api-dl — Haque, M. S. & M. B. E. Godward. 1985. Comparison between two genera, species and cultivars in Lactuceae 1. Karyotype analysis. Cytologia 50: 725–738.
CCDB · ipcn-api-dl — Haque, M. S. & M. B. E. Godward. 1986. Comparison between two genera, species and cultivars in Lactuceae III. DNA amount and radiosensitivity. Cytologia 51: 341–348.
CCDB · ipcn-api-dl — Ghaffari, S. M. 1987. Chromosome studies in some flowering plants of Iran. Rev. Cytol. Biol. Vég., Bot. 10: 3–8.
CCDB · ipcn-api-dl — Rudyka, E. G. 1990. Chromosome numbers of vascular plants from the various regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1783–1786.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Mejías, J. A. 1992. Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113–130.
CCDB · ipcn-api-dl — Koopman, W. J. M., J. H. D. Jong & I. M. d. Vries. 1993. Chromosome banding patterns in lettuce species (Lactuca sect. Lactuca, Compositae). Pl. Syst. Evol. 185: 249–257.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Koopman, W. J. M. & J. H. D. Jong. 1996. A numerical analysis of karyotypes and DNA amounts in lettuce cultivars and species (Lactuca subsect. Lactuca, Compositae). Acta Bot. Neerl. 45(2): 211–222.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Gallego, M. J. 1981. In Numeros cromosomicos para la flora Esparhol. 182-256. Lagascalia 10: 225–256.
CCDB · ipcn-api-dl — Bachmann, K. A. & H. J. Price. 1977. Repetitive DNA in Cichoricae (Compositae). Chromosoma 61: 267–275.
CCDB · ipcn-api-dl — Kuzmanova, B. & S. Georgieva. 1980. In Chromosome number reports LXIX. Taxon 29: 715.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1977. Contribution to the karyological study of the species of Slovakian flora. Biologia (Bratislava) 32: 243–254.
CCDB · ipcn-api-dl — Ferakova, V. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.
+45 more references
2n 05×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bachmann, K. A. & Price, H. J. (1977). Repetitive DNA in Cichoricae (Compositae). Chromosoma 61: 267–275.
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1976). Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
CCDB · CromoCat 2015 — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. (1978). Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
n 918×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · iber-fl — Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Mejas, J. A.Bot. Helvetica103: 113-130(1993).
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Bachmann, K. A. & H. J. Price. 1977. Repetitive DNA in Cichoricae (Compositae). Chromosoma 61: 267–275.
CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Koul, A. K., A. K. Wakhlu & J. L. KARIHALOO. 1976a. Chromosome numbers of some flowering plants of Jammu (western Himalayas). II. CIS Chromosome Inform. Serv. 20: 32–33.
CCDB · book-ipcn67-71 — CHATTERJEE, T., & A.K. SHARMA. 1969. Cytotaxonomy of Cichoreae. Genetica 40: 577-590.
CCDB · CromoCat 2015 — Chatterjee, T. & Sharma, A. K. (1969). Cytotaxonomy of Cichoreae. Genetica 40: 577-590.
CCDB · CromoCat 2015 — Ghaffari, S. M. & Chariat-Panahi, M. S. (1985b). Chromosome counts of some Angiosperms from Iran. Iranian J. Bot. 3: 68-73.
CCDB · CromoCat 2015 — Mejías, J. A. (1993a). Cytotaxonomic studies in the Iberian taxa of the genus Lactuca (Compositae). Bot. Helv. 103: 113-130.
CCDB · CromoCat 2015 — Bachmann, K. A. & Price, H. J. (1977). Repetitive DNA in Cichoricae (Compositae). Chromosoma 61: 267–275.
CCDB · CromoCat 2015 — Keil, D. J. & Pinkava, D. J. (1976). Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
CCDB · CromoCat 2015 — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. (1978). Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bachmann, K. A. & Price, H. J. (1977). Repetitive DNA in Cichoricae (Compositae). Chromosoma 61: 267–275.
CCDB · CromoCat 2015 — Kamel (2004). Cytotaxonomical investigations of the Egyptian Compositae (Asteraceae): I—Cardueae and Cichorieae. Compositae Newslett. 41: 9–28.
CCDB · CromoCat 2015 — Krasnikov, A. A., Zhirova, O. S., Lomonosova, M. N. & Smirnov, S. V. (2003). Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. 88(9): 151–153.
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time~0.21 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.21 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type344 749 records
Wild obs. + sensor328 672
Museum / vouchered11 416
Cultivated / captive815
Other3 846
Origin
Native3 818
Introduced17 474
Range
Area of Occupancy AOO473 972 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 68 373≤1 km 38 877≤10 km 162 549>10 km 3 115
272 914 georeferenced · 55 758 without coordinates
Open the mapobservation + sensor328 672
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 1 270≤1 km 1 743≤10 km 3 064>10 km 220
6 297 georeferenced · 5 119 without coordinates
Open the institutions mapphysical evidence11 416
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy84% within 1 km
≤1 km 43≤10 km 6>10 km 2
51 georeferenced · 764 without coordinates
Open the mapnot free-living815
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions231 of 411 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 760 |
| NLD037location not on record | 541 |
| BFLlocation not on record | 293 |
| Wuzhou, CN | 285 |
| Moscow State Universitylocation not on record | 254 |
| LDlocation not on record | 217 |
| San Diego, US | 216 |
| Berlin, DE | 215 |
| ASUlocation not on record | 195 |
| Olocation not on record | 181 |
| Claremont, US | 166 |
| Uniwersytet Warszawskilocation not on record | 150 |
| BRNUlocation not on record | 122 |
| South Kensington, GB | 120 |
| Chongqing Museumlocation not on record | 116 |
| Riverside, US | 113 |
| Madison, US | 100 |
| Museo Entomologico de Leonlocation not on record | 86 |
| Santa Barbara, US | 83 |
| Bloomington, US | 80 |
| Provincia di Livornolocation not on record | 79 |
| Austin, US | 79 |
| GMBAlocation not on record | 76 |
| Pullman, US | 75 |
| Christchurch, NZ | 73 |
| Bern, CH | 73 |
| Denver, US | 70 |
| SLU Artdatabankenlocation not on record | 67 |
| Fort Worth, US | 67 |
| Chapel Hill, US | 65 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 64 |
| Chadron, US | 63 |
| Flagstaff, US | 62 |
| València, ES | 62 |
| St. Paul, US | 60 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 60 |
| Oskarshamn, SE | 60 |
| BDBClocation not on record | 59 |
| Görlitz, DE | 56 |
| Davis, US | 55 |
| Saint Louis, US | 51 |
| QAUlocation not on record | 51 |
| Tartu, EE | 50 |
| Albuquerque, US | 49 |
| Moscow, US | 49 |
| Turku, FI | 48 |
| WTUlocation not on record | 46 |
| College of the Atlantic, Museumlocation not on record | 45 |
| Bozeman, US | 44 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 44 |
| Barcelona, ES | 43 |
| Palmerston, AU | 41 |
| University of Stellenboschlocation not on record | 41 |
| Nagano City, JP | 40 |
| Canadian Department of Agriculturelocation not on record | 40 |
| Adam Mickiewicz University in Poznańlocation not on record | 40 |
| MAlocation not on record | 39 |
| Philadelphia, US | 39 |
| Zürich, CH | 39 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| Ann Arbor, US | 38 |
| Rishon Le Zion, IL | 37 |
| DOI/NPS, Greenbelt Parklocation not on record | 36 |
| Pretoria, ZA | 35 |
| San Luis Obispo, US | 34 |
| Corvallis, US | 33 |
| Williamsburg, US | 33 |
| Bronx, US | 32 |
| BClocation not on record | 32 |
| GJOlocation not on record | 32 |
| Entomological Society of Latvialocation not on record | 31 |
| Durango, MX | 30 |
| Vitoria, ES | 30 |
| Beijing, CN | 29 |
| Missoula, US | 29 |
| Córdoba, AR | 29 |
| Emporia, US | 28 |
| Phoenix, US | 28 |
| CASlocation not on record | 28 |
| Texas Lutheran Universitylocation not on record | 27 |
| Montréal, CA | 27 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 26 |
| Salzburg, AT | 26 |
| Cape Town, ZA | 25 |
| Zürich, CH | 25 |
| Mexico City, MX | 24 |
| US | 24 |
| Pocatello, US | 24 |
| Uppsala, SE | 24 |
| Burlington, US | 23 |
| Oulu, FI | 23 |
| Córdoba, ES | 23 |
| Frankfurt am Main | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 22 |
| Salamanca, ES | 21 |
| Auckland, NZ | 21 |
| Jackson, US | 19 |
| Adelaide, AU | 19 |
| Vancouver, CA | 19 |
| Bangkok, TH | 18 |
| EL PASO, US | 18 |
| Pamplona, ES | 18 |
| Pittsburg, US | 17 |
| Toronto, CA | 17 |
| Kensington, AU | 17 |
| San Isidro, AR | 17 |
| University of New Hampshirelocation not on record | 17 |
| Caldwell, US | 16 |
| Acadia Universitylocation not on record | 16 |
| Spearfish, US | 16 |
| Blumenau, BR | 15 |
| Québec, CA | 15 |
| CJBGlocation not on record | 15 |
| Shinshu Universitylocation not on record | 15 |
| Provo, US | 15 |
| Logan, US | 14 |
| Wellington, NZ | 13 |
| Boise, US | 13 |
| Mlocation not on record | 13 |
| Angwin, US | 13 |
| Canberra, AU | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| CICYTEXlocation not on record | 12 |
| IDElocation not on record | 12 |
| Los Angeles, US | 12 |
| College Park, US | 12 |
| Mexico City, MX | 12 |
| Fayetteville, US | 11 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Madrid, ES | 11 |
| ISAlocation not on record | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 11 |
| San Sebastián, ES | 11 |
| Lubbock, US | 11 |
| Chicago, US | 10 |
| Dekalb, US | 10 |
| Armidale, AU | 10 |
| Odawara, JP | 10 |
| Irvine, US | 10 |
| Victoria, CA | 10 |
| University of Alberta Museumslocation not on record | 10 |
| Severin-McDaniel Insect Collectionlocation not on record | 10 |
| Wlocation not on record | 10 |
| Urumqi, CN | 10 |
| Tallinn, EE | 10 |
| TUR-Alocation not on record | 10 |
| Arcata, US | 10 |
| UChlocation not on record | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 9 |
| UTFPR-CPlocation not on record | 9 |
| Lincoln, US | 9 |
| GB | 8 |
| Columbia, US | 8 |
| Green Bay, US | 8 |
| Yangling, CN | 8 |
| John T. Waterhouse Herbariumlocation not on record | 8 |
| JP | 8 |
| Granada, ES | 8 |
| Badajoz, ES | 7 |
| Morgantown, US | 7 |
| Campo Mourão, BR | 7 |
| Mount Annan, AU | 7 |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Bergen, NO | 7 |
| Juriquilla, MX | 7 |
| Whitewater, US | 7 |
| CZE061location not on record | 7 |
| Stockholm, SE | 7 |
| Laboratory of Palaeontologylocation not on record | 7 |
| Portland, US | 6 |
| KIRMlocation not on record | 6 |
| Alicante, ES | 6 |
| Tlalnepantla, MX | 6 |
| KMNlocation not on record | 6 |
| Knoxville, US | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| Museum of the Rockieslocation not on record | 6 |
| New Brunswick, US | 6 |
| Kew, GB | 6 |
| Harrisonburg, US | 6 |
| Torreón, MX | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Porrentruy, CH | 5 |
| Tilburg, NL | 5 |
| San Francisco, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| PrivatHerblocation not on record | 5 |
| Trondheim, NO | 5 |
| USFS/BHSClocation not on record | 5 |
| HUN003location not on record | 5 |
| San Angelo, US | 5 |
| GBR006location not on record | 5 |
| Millersville, US | 5 |
| Osaka, JP | 5 |
| Hermosillo, MX | 5 |
| Jefferson City, US | 5 |
| WNNUlocation not on record | 5 |
| Grand Junction, US | 5 |
| La Paz, MX | 5 |
| Paris, FR | 5 |
| Kirksville, US | 5 |
| Saint John, CA | 5 |
| Dresden, DE | 5 |
| Valdosta State Universitylocation not on record | 5 |
| GZUlocation not on record | 4 |
| Toyama, JP | 4 |
| Brisbane, AU | 4 |
| Mississippi State, US | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 4 |
| Université Lavallocation not on record | 4 |
| Ivano-Frankove, UA | 4 |
| Philadelphia, US | 4 |
| AUAlocation not on record | 4 |
| Sevilla, ES | 4 |
| UNESClocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Northridge, US | 4 |
| SIHUlocation not on record | 4 |
| Jyväskylä, FI | 4 |
| Springfield, US | 4 |
| Clemson, US | 4 |
| Frauenfeld, CH | 4 |
| Karlsruhe, DE | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Otaru, JP | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| Winterthur, CH | 4 |
| JBSlocation not on record | 4 |
| Henderson, US | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Tempe, US | 4 |
| PRClocation not on record | 4 |
| Zapopan, MX | 4 |
| DBF-NHMDlocation not on record | 4 |
| Tacoma, US | 4 |
| Montecillo, Texcoco, MX | 4 |
| USFSlocation not on record | 4 |
| Catalina Island Conservancylocation not on record | 4 |
| Ashland, US | 3 |
| Corrientes, AR | 3 |
| MeiseBGlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| Little Rock, US | 3 |
| Mohonk Preservelocation not on record | 3 |
| Macomb, US | 3 |
| Qufu Normal Universitylocation not on record | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Zacatecas, MX | 3 |
| Criciúma, BR | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| UFSClocation not on record | 3 |
| Ciudad Autónoma de Buenos Aires, AR | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Jaén, ES | 3 |
| Turlock, US | 3 |
| Bando, JP | 3 |
| Fukushima Universitylocation not on record | 3 |
| Orem, US | 3 |
| PUC-RSlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| Hudson, US | 2 |
| Podgorica, ME | 2 |
| Austin, US | 2 |
| Chicago, US | 2 |
| Minia, EG | 2 |
| Sion, CH | 2 |
| Parkville, AU | 2 |
| Durango, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| Santa Cruz, US | 2 |
| TROMlocation not on record | 2 |
| Fulda, DE | 2 |
| Helsinki, FI | 2 |
| Tampa, US | 2 |
| SEFlocation not on record | 2 |
| Ensenada, MX | 2 |
| EEZA-CSIClocation not on record | 2 |
| Castelar, AR | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Edmonton, CA | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| KURAlocation not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Washington, US | 2 |
| Norfolk, US | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Whitehorse, CA | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| Namur, BE | 2 |
| WINlocation not on record | 2 |
| Tomioka, JP | 2 |
| Stephenville, US | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Fairfax, US | 1 |
| Umeå Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| UNISANTAlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Chengdu, CN | 1 |
| Xining, CN | 1 |
| CIBIOlocation not on record | 1 |
| San Jose, US | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Fargo, US | 1 |
| Richmond, US | 1 |
| The University of Arizonalocation not on record | 1 |
| Nijmegen, NL | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Rotorua, NZ | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Long Beach, US | 1 |
| FUVATESlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Bourges, FR | 1 |
| Viña del Mar, CL | 1 |
| Pamplona, ES | 1 |
| FLADlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Sagamihara, JP | 1 |
| Truckee, US | 1 |
| Philadelphia, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Durban, ZA | 1 |
| LINUlocation not on record | 1 |
| Russellville, US | 1 |
| Miami, US | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| OLAlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Kunming, CN | 1 |
| Kushiro City Museumlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Urumqi, CN | 1 |
| MMHNSRlocation not on record | 1 |
| Guasave, MX | 1 |
| Brock University (BU)location not on record | 1 |
| VALElocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| STNFlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Kuopio, FI | 1 |
| LfUlocation not on record | 1 |
| Loja, EC | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| TAIElocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Coimbra, PT | 1 |
| UIBlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| MSB-2797location not on record | 1 |
| Trois-Rivières, CA | 1 |
| Tuscaloosa, US | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| ESP027location not on record | 1 |
| Edinburgh, GB | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Göteborg, SE | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Hamilton, US | 1 |
| Cheney, US | 1 |
| HJAEFlocation not on record | 1 |
| Bend, US | 1 |
| Seropédica, BR | 1 |
| UNIVILLElocation not on record | 1 |
| Pelotas, BR | 1 |
| GAlocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Smithfield, AU | 1 |
| Palmerston North, NZ | 1 |
| QVMAGlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Hobart, AU | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| ESP004location not on record | 1 |
| Bothell, US | 1 |
| Oswego, US | 1 |
| Tula State Universitylocation not on record | 1 |
| JBRJlocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Kochi, JP | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| SWlocation not on record | 1 |
411 institutions · 9 953 of 11 416 vouchered records shown · 1 296 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA96 detections
Where the DNA of Lactuca serriola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found96
Studies independent surveys3
Countries13
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 96 detections have coordinates
Open the map13 countries0
Disturbed area with dry soilroadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.7 °C 9.70–24.9
Seasonal swing summer↔winter24.5 °C
Max temp (day)26.8 °C 14.2–31.6
Min temp (night)17.2 °C 5.70–18.8
Precipitation59.0 mm/mo 34.6–146
Air humidity57.2 % 47.7–64.8
Moisture balance-64.7 mm/mo -137–38.6
Vapour deficit967 Pa 517–1,643
Wind speed2.80 m/s 2.50–3.90
Cloud cover31.7 % 17.5–44.6
CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.