Lactuca palmensis

Bolle · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Lactuca

At a glance

Occurrence records59

Data sources8

Biological traits19

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Lactuca palmensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources19 traits

Occurrence & distributionGBIF59 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT≈720 Mbp

01Narrative

Lactuca palmensis is a species of wild lettuce endemic to the Canary Islands. DNA evidence shows that it is closely related to the African and European species of Lactuca, while the Azores endemic Lactuca watsoniana is more closely related to the North American lineage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Size & morphology2

Plant height max0.4 m

Plant height min0.2 m

Life cycle & reproduction8

Dehiscenceindehiscent

Flower colourblue

Flower width max3 mm

Flower width min2 mm

Flowering endOct

Flowering startJun

Life spanannual

Raunkiær life formtherophyte

Habitat & environment7

Elevation max2 400 m

Elevation min200 m

Fruit colourbrown

Fruit typeachene

Growth formherb

Leaf formpinnatisect

Woodinessnon-woody

Other traits2

Inflorescencepanicle

Leaf arrangementrosette

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca palmensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSKY067186.1 ↗624 bp

ACGT

TCGAACATTGCAAGGTAGAACGACCTGTGAACAAGTAACCACAACTGGGAGATAGGGAAATGGGCCTTGGACCTTCCCTTGAAACCTTAT …

Lactuca palmensis isolate LP1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Lactuca palmensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈720 000 000 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lactuca palmensis0.72 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelscaffold

08Occurrence & distribution

Record type59 records

Wild obs. + sensor56

Museum / vouchered3

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 7≤1 km 12≤10 km 33

52 georeferenced · 4 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Montréal, CA	1
University of Stellenboschlocation not on record	1

3 institutions · 3 of 3 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)