Lactuca inermis

Forssk. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Lactuca

At a glance

Occurrence records1 054

Data sources10

Biological traits18

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Lactuca inermis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 054 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF1 054 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Lactuca inermis is a species of wild lettuce native to sub-Saharan Africa, Madagascar, and the Arabian peninsula. A pioneer species often found in disturbed areas, it is of variable height, from very short (5cm) to quite tall (240cm) and woody. Local people consume its young leaves, perhaps with a light boiling, as a salad green or vegetable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height1 m

⚠ sources differ — GIFT: 1 m · TRY: 0.4 m

Plant height max1.52 m

Seed mass0.884 mg

Life cycle & reproduction3

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Lifespan years2 years

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 200 m

Elevation min100 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTgrassland and a weed of cultivation, on fallow land, roadsides

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca inermis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences9

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLT721938.1 ↗626 bp

ACGT

TCGAACACTGCAAGGTAGAACGACCTGTGAACAAGTAACCACAATTGGGAGATAGGGAAATGGGCCTTGGTCCTTCTCTTGAAACCTTAT …

Lactuca inermis genomic DNA sequence contains ITS1, 5.8S rRNA gene and ITS2, isolate LAC-177, specimen voucher J. Meister (B)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lactuca inermis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · kew +1

CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.

CCDB · book-fedorov — Babcock et al. '1937

CCDB · kew — Doležalová I, Lebeda A, Janecek J, Cíhalíková J, Krístková E, Vránova O. 2002. Variation in chromosome numbers and nuclear DNA contents in genetic resources of Lactuca L. species (Asteraceae). Genetic Resources and Crop Evolution 49: 383-395.

CCDB · iapt — IAPT/IOPB Chromosome Data 27

n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, L. S. & D. I. Omoigui. 1992. Chromosome numbers in some Nigerian Compositae. Compositae Newslett. 20/21: 12–15.

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytology of some weedy species of the family Compositae (Asteraceae) from Jos Plateau, Nigeria. Feddes Repert. 101: 49–62.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 054 records

Wild obs. + sensor412

Museum / vouchered552

Cultivated / captive1

Other89

Range

Area of Occupancy AOO2 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 203≤1 km 54≤10 km 6>10 km 3

266 georeferenced · 146 without coordinates

Open the mapobservation + sensor412

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤1 km 13≤10 km 6>10 km 2

21 georeferenced · 531 without coordinates

Open the institutions mapphysical evidence552

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	228
Kew, GB	77
Durban, ZA	37
HNBlocation not on record	19
Saint Louis, US	14
Paris, FR	12
Olocation not on record	11
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	11
Cape Town, ZA	11
Berlin, DE	8
MeiseBGlocation not on record	7
Stockholm, SE	7
Edinburgh, GB	7
University of Stellenboschlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	5
Moscow State Universitylocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	4
Herbier National du Gabonlocation not on record	4
Instituto de Investigação Científica Tropicallocation not on record	4
MAlocation not on record	3
Wlocation not on record	3
CJBGlocation not on record	2
San Luis Obispo, US	2
Forest Herbarium Ibadan (FHI)location not on record	1
LSFlocation not on record	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
MSB-3054location not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

28 institutions · 491 of 552 vouchered records shown · 61 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Lactuca inermis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)26.8 °C

Min temp (night)13.1 °C

Precipitation63.2 mm/mo

Air humidity50.0 %

Moisture balance-86.2 mm/mo

Vapour deficit1,175 Pa

Wind speed3.00 m/s

Cloud cover16.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lactuca inermis

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 054 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 054 records