Lactuca hirsuta — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Lactuca

At a glance

Occurrence records433

Data sources7

Biological traits9

DNA specimens6

eDNA detections3

Sources7 archives

Databases and archives Lactuca hirsuta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF433 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

الخس الدموي صنف بري يتبع نوع الخس الشعري من جنس الخس من الفصيلة النجمية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.0000000298

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lactuca hirsuta has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218440.1 ↗297 bpCanada · 1980

ACGT

TCCGGCCGAAGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCACCATACTCCTCCAATGGGTTGTGATGGTGTTAGGGGCGGA …

Lactuca hirsuta voucher CCDB-22991-F12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL4rbcLaITS4ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type433 records

Wild obs. + sensor231

Museum / vouchered197

Other5

Range

Area of Occupancy AOO1 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 122≤1 km 15≤10 km 10>10 km 41

188 georeferenced · 43 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 12≤1 km 42≤10 km 63>10 km 10

127 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	34
Bronx, US	24
New Haven, US	16
Chapel Hill, US	15
Madison, US	12
University of New Hampshirelocation not on record	10
Saint Louis, US	10
Burlington, US	9
Bangkok, TH	6
University of Stellenboschlocation not on record	6
Toronto, CA	5
Bloomington, US	5
Montréal, CA	5
Fairfax, US	3
Austin, US	3
Jefferson City, US	3
Jackson, US	3
Chongqing Museumlocation not on record	3
Columbia, US	2
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	2
Williamsburg, US	2
Université Lavallocation not on record	2
Fort Worth, US	2
Knoxville, US	1
US	1
Little Rock, US	1
Clemson, US	1
Northridge, US	1
Pittsburg, US	1
Durham, US	1
Minia, EG	1
EL PASO, US	1
Morgantown, US	1
GB	1
Mount Berry, US	1
University of North Carolina at Pembrokelocation not on record	1
New Brunswick, US	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1

38 institutions · 197 of 197 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Lactuca hirsuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

Open Quercus alba-Quercus rubra woods, thin …Dry place clearing coniferous woods.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.