Lacinipolia stricta

Walker, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Lacinipolia

At a glance

Occurrence records573

Data sources7

Biological traits0

DNA specimens33

eDNA detections31

Sources7 archives

Databases and archives Lacinipolia stricta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility573 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF573 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD33 specimens

01Narrative

Lacinipolia stricta, the brown arches moth, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Lacinipolia stricta is 10398.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lacinipolia stricta has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

214Amostly conserved

220Tmostly conserved

451Cmostly conserved

542Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCATTAAGATTACTCATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lacinipolia circumcinctasame genus3.6%Lacinipolia spiculosasame genus5.2%Psammopolia arietissame family5.8%Orthodes cynicasame family6.4%Lacinipolia stenotissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type573 records

Wild obs. + sensor155

Museum / vouchered418

Origin

Native1

Range

Area of Occupancy AOO912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 88≤1 km 12≤10 km 8>10 km 11

119 georeferenced · 36 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 46≤1 km 24≤10 km 21>10 km 6

97 georeferenced · 321 without coordinates

Open the institutions mapphysical evidence418

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	138
Colorado State Universitylocation not on record	64
University of Alberta Museums (UAM)location not on record	50
Vernal, US	46
St. Paul, US	19
New Haven, US	18
WWUlocation not on record	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
San Diego, US	7
Essig Museum of Entomologylocation not on record	5
National Institute of Biological Resourceslocation not on record	3
Santa Barbara Museum of Natural Historylocation not on record	2
Santa Cruz, US	2
Natural History Museum of Utahlocation not on record	1
Denver, US	1
Philadelphia, US	1
Mississippi State, US	1
Centre for Biodiversity Genomicslocation not on record	1
Los Angeles, US	1
East Lansing, US	1

20 institutions · 393 of 418 vouchered records shown · 25 without an institution code

09Environmental DNA31 detections

Where the DNA of Lacinipolia stricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate GrasslandMixed habitat4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C -8.00–19.3

Seasonal swing summer↔winter25.2 °C

Max temp (day)22.4 °C -3.80–26.2

Min temp (night)10.1 °C -13.1–12.9

Precipitation38.4 mm/mo 24.4–46.8

Air humidity53.1 % 49.8–64.8

Moisture balance-57.8 mm/mo -95.3–23.6

Vapour deficit846 Pa 122–1,076

Wind speed1.60 m/s 1.50–2.50

Cloud cover38.0 % 32.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)