Lachnostachys eriobotrya

(F.Muell.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Lachnostachys

At a glance

Occurrence records390

Data sources7

Biological traits21

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Lachnostachys eriobotrya's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF390 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Lachnostachys eriobotrya (common name - Lambswool) is a plant in the Lamiaceae family, native to Western Australia. It was first described by Ferdinand von Mueller in 1859 as Walcottia eriobotrya', but was transferred to the genus Lachnostachys in 1917 by George Claridge Druce.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Plant height1.5 m

⚠ sources differ — AusTraits: 1.5 m · TRY: 1 m

Plant height max2 m

Plant height min0.5 m

Seed mass0.896 mg

Life cycle & reproduction6

Flowering timennnnyyyyyynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lachnostachys eriobotrya has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ381166.1 ↗603 bp

ACGT

GAAACCTGCAAATCAGACCGCGAACACGTGATTAAAGCACAGGGACCGCGGTGAGGGGGGAAACCTCCGATCGCGGTGCCATCCCCGCCG …

Lachnostachys eriobotrya internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type390 records

Wild obs. + sensor85

Museum / vouchered305

Origin

Native14

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 32≤1 km 12≤10 km 7>10 km 13

64 georeferenced · 21 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 37≤1 km 30≤10 km 151>10 km 25

243 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	143
Adelaide, AU	42
Museo Entomologico de Leonlocation not on record	38
Canberra, AU	31
Mount Annan, AU	14
Kew, GB	7
BGPAlocation not on record	7
Brisbane, AU	5
Claremont, US	4
Hobart, AU	3
Stockholm, SE	2
Boise, US	1
MAlocation not on record	1
MeiseBGlocation not on record	1
Armidale, AU	1
Madison, US	1
Smithfield, AU	1

17 institutions · 302 of 305 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Lachnostachys eriobotrya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)