Lachnellula willkommii

(R.Hartig) Dennis · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Lachnaceae/Lachnellula

At a glance

Occurrence records515

Data sources9

Biological traits0

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Lachnellula willkommii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility515 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF515 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈51 Mbp

01Narrative

Lachnellula willkommii is a species of fungi belonging to the family Lachnaceae. It is native to Eurasia and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lachnellula willkommii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences8

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX894919.1 ↗511 bpCzech Republic · 2015

ACGT

CTGCGGAAGGATCATTACAGAGTTCATGCCCGTACGGGTAGATCTCCCACCCTTGTATATATAATTATCTGTTGCTTTGGCGGGCCGCGA …

Lachnellula willkommii strain S55/15 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Lachnellula willkommii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈51 034 129 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Lachnellula willkommii0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness83.7% BUSCO

08Occurrence & distribution

Record type515 records

Wild obs. + sensor293

Museum / vouchered222

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 32≤1 km 18≤10 km 204>10 km 20

274 georeferenced · 19 without coordinates

Open the mapobservation + sensor293

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 6≤1 km 61≤10 km 92>10 km 2

161 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	56
Olocation not on record	28
Tartu, EE	23
GJOlocation not on record	22
Philadelphia, US	8
Uniwersytet Łódzkilocation not on record	7
CJBGlocation not on record	6
WU-MYClocation not on record	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Copenhagen, DK	4
Görlitz, DE	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Champaign, US	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Karlsruhe, DE	3
Kew, GB	3
Kuopio, FI	2
Joensuu, FI	2
Adam Mickiewicz University in Poznańlocation not on record	2
Zürich, CH	2
LDlocation not on record	1
Slovenian Forestry Institutelocation not on record	1
Tomioka, JP	1
Bronx, US	1
Uppsala, SE	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
DPIlocation not on record	1
Salzburg, AT	1
Gijón, ES	1
Trondheim, NO	1
Catholic University of Pekinglocation not on record	1
SLU Artdatabankenlocation not on record	1

32 institutions · 204 of 222 vouchered records shown · 18 without an institution code

09Environmental DNA2 detections

Where the DNA of Lachnellula willkommii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)