Lachnagrostis billardierei

(R.Br.) Trin. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Lachnagrostis

At a glance

Occurrence records1 596

Data sources11

Biological traits41

DNA specimens6

eDNA detections10

Sources11 archives

Databases and archives Lachnagrostis billardierei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 596 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF1 596 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT6.5 Gbp

01Narrative

Lachnagrostis billardierei, commonly known as coast blown-grass or sand wind grass, is a species of plant in the true grass family. The genus name means “woolly agrostis” with reference to the closely related genus Agrostis; the specific epithet billardierei honours French botanist Jacques Labillardière (1755-1834).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Leaf length250 mm

Leaf length max170 mm

Leaf length min4 mm

Leaf size1 374 mm²

Leaf width4 mm

Leaf width max8 mm

Leaf width min2 mm

Plant height0.35 m

⚠ sources differ — GIFT: 0.35 m · AusTraits: 0.55 m

Plant height max0.6 m

Seed length3.5 mm

⚠ sources differ — AusTraits: 3.5 mm · GIFT: 1.6 mm

Seed length max1.6 mm

Seed length min1.6 mm

Seed mass0.21 mg

Seed mass max0.21 mg

Seed mass min0.21 mg

Seed width2 mm

⚠ sources differ — AusTraits: 2 mm · GIFT: 0.6 mm

Seed width max0.6 mm

Seed width min0.6 mm

Life cycle & reproduction9

Dispersal typeanimal

Flowering timennnnnnnnyyyy

Life formperennial or annual

Life spanannual

Pollination modeabiotic

Pollination syndromeabiotic

⚠ sources differ — AusTraits: abiotic · GIFT: wind

Raunkiær life formtherophyte

Reproduction asexualabsent

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTCoastal

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lachnagrostis billardierei has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences3

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ196066.1 ↗666 bpAustralia

ACGT

TGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAGCCTGTCGGCGGTGACACCGTTCATCGC …

Lachnagrostis billardierei subsp. billardierei voucher Kraehenbuehl 5369 (AD) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Lachnagrostis billardierei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 515 925 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Lachnagrostis billardierei6.52 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidy8× octoploid · measured

Chromosome records56–562n range56median56mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 566×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J. & B. G. Murray. 2002. Contributions to a chromosome atlas of the New Zealand flora---37. Miscellaneous families. New Zealand J. Bot. 40: 1–23.

CCDB · ipcn-api-dl — Murray, B. G., P. J. de Lange & A. R. Ferguson. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Ann. Bot. (Oxford) 96: 1293–1305.

CCDB · kew — Murray BG, De Lange PJ, Ferguson AR. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Annals of Botany 96: 1293-1305.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

octoploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 596 records

Wild obs. + sensor1 289

Museum / vouchered307

Origin

Native16

Range

Area of Occupancy AOO2 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 416≤1 km 93≤10 km 21>10 km 9

539 georeferenced · 750 without coordinates

Open the mapobservation + sensor1 289

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 20≤1 km 18≤10 km 20>10 km 2

60 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	172
Wellington, NZ	62
Christchurch, NZ	22
Rotorua, NZ	11
Palmerston North, NZ	5
State Herbarium of South Australialocation not on record	4
National Herbarium of Victorialocation not on record	4
Hobart, AU	4
Museo Entomologico de Leonlocation not on record	3
South Kensington, GB	3
QVMAGlocation not on record	3
Batemans Bay, AU	3
Palmerston, AU	3
Mount Annan, AU	2
EL PASO, US	1
Brisbane, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
Canberra, AU	1
Adelaide, AU	1

20 institutions · 307 of 307 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Lachnagrostis billardierei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 14.5–18.7

Seasonal swing summer↔winter7.00 °C

Max temp (day)18.5 °C 16.4–24.2

Min temp (night)12.9 °C 12.3–14.1

Precipitation56.4 mm/mo 26.2–101

Air humidity58.2 % 53.6–61.1

Moisture balance-88.5 mm/mo

Vapour deficit737 Pa 636–1,006

Wind speed5.00 m/s

Cloud cover21.8 % 19.8–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lachnagrostis billardierei

At a glance

Sources11 archives

Size & morphology18

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 596 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 596 records