Lachenalia unifolia

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Lachenalia

At a glance

Occurrence records739

Data sources10

Biological traits17

DNA specimens24

eDNA detections13

Sources10 archives

Databases and archives Lachenalia unifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility739 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF739 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Lachenalia unifolia là một loài thực vật có hoa trong họ Măng tây. Loài này được Jacq. mô tả khoa học đầu tiên năm 1797.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.34 m

Plant height min0.1 m

Seed mass0.673 mg

Seed mass max0.94 mg

Seed mass min0.43 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max914 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Lachenalia unifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Luteolin 3'-sulfate	present	LOTUS
Luteolin 4'-methyl ether 3'-sulfate	present	LOTUS
Tricetin 3'-sulfate	present	LOTUS
Tricetin 7,3'-disulfate	present	LOTUS

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lachenalia unifolia has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes6

GenBank sequences2

eDNA detections13

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB305003.1 ↗652 bp

ACGT

TCGAGGCCCGAACGGAAAATCGTGAACCAGTCAACCCCCTGTGAGGGCGGAGGGGGCGCCATGGTGCGCCTTCCCCCCGCCCTCGTCGGG …

Lachenalia unifolia genes for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS1★ITS2rpoB

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Lachenalia unifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 8

CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.948 ↗

08Occurrence & distribution

Record type739 records

Wild obs. + sensor574

Museum / vouchered165

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 404≤1 km 50≤10 km 6>10 km 11

471 georeferenced · 103 without coordinates

Open the mapobservation + sensor574

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	93
Pretoria, ZA	54
University of the Free Statelocation not on record	11
South African National Biodiversity Institutelocation not on record	2
MSB-3054location not on record	1
GHPG$location not on record	1
University of Johannesburglocation not on record	1
Moscow State Universitylocation not on record	1
Philadelphia, US	1

9 institutions · 165 of 165 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Lachenalia unifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 18.5–24.3

Seasonal swing summer↔winter11.3 °C

Max temp (day)26.2 °C 25.1–31.4

Min temp (night)15.3 °C 11.8–16.9

Precipitation29.2 mm/mo 11.7–72.8

Air humidity55.4 % 49.8–59.0

Moisture balance-160 mm/mo -184–-54.1

Vapour deficit1,037 Pa 946–1,482

Wind speed3.90 m/s 3.00–4.90

Cloud cover12.8 % 10.6–15.1

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)