Lachenalia mutabilis

G.Lodd. ex Schult. & Schult.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Lachenalia

At a glance

Occurrence records593

Data sources8

Biological traits17

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Lachenalia mutabilis's data was compiled from.

GBIFGlobal Biodiversity Information Facility593 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF593 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology3

Plant height max0.44 m

Plant height min0.1 m

Seed mass1.31 mg

Life cycle & reproduction4

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max915 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: geophyte

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lachenalia mutabilis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB304989.1 ↗651 bp

ACGT

TCGAGACCCGAACGGAAGATCGTGAACCAGTCAACCCCCCGTGAGGACGGTGGGGGCGCCATAGTGCGCCTTTCCCGGCCTTGTTGGGGG …

Lachenalia mutabilis genes for ITS1, 5.8S rRNA, ITS2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lachenalia mutabilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records12–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 5

CCDB · ipcn-api-dl — Hancke, F. L. & H. Liebenberg. 1990. B-Chromosomes in some Lachenalia species and hybrids. S. African J. Bot. 56: 659–664.

CCDB · ipcn-api-dl — Hamatani, S., K. Hashimoto & K. Kondo. 1998. A comparison of somatic chromosome at metaphase in Lachenalia (Liliaceae). Chromosome Sci. 2: 21–25.

2n 121×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 8

n 51×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Orndoff & Watters 1978

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hancke, F. L. & H. Liebenberg. 1998. Meiotic studies of interspecific Lachenalia hybrids and their parents. S. African J. Bot. 64: 250–255.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type593 records

Wild obs. + sensor452

Museum / vouchered141

Range

Area of Occupancy AOO1 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 289≤1 km 64≤10 km 18>10 km 16

387 georeferenced · 65 without coordinates

Open the mapobservation + sensor452

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 141 records without

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	101
Pretoria, ZA	37
South African National Biodiversity Institutelocation not on record	1
MSB-3054location not on record	1
Kew, GB	1

5 institutions · 141 of 141 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Lachenalia mutabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)