Laccaria vinaceobrunnea

G.M.Muell. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hydnangiaceae/Laccaria

At a glance

Occurrence records60

Data sources6

Biological traits0

DNA specimens5

eDNA detections7

Sources6 archives

Databases and archives Laccaria vinaceobrunnea's data was compiled from.

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Laccaria vinaceobrunnea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences7

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT594626.1 ↗348 bpJapan

ACGT

TAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGA …

Laccaria vinaceobrunnea strain OTU1024 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor3

Museum / vouchered57

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 5>10 km 1

10 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	19
Mexico City, MX	9
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	7
Chicago, US	6
FLASlocation not on record	4
Colorado State Universitylocation not on record	2
Baton Rouge, US	1
University of Tennessee at Chattanoogalocation not on record	1
Tampa, US	1

9 institutions · 50 of 57 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Laccaria vinaceobrunnea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 12.2–16.9

Seasonal swing summer↔winter5.90 °C

Max temp (day)18.9 °C 16.1–21.5

Min temp (night)8.40 °C 6.90–11.9

Precipitation242 mm/mo 164–355

Air humidity67.5 % 64.1–72.6

Moisture balance124 mm/mo 47.2–237

Vapour deficit553 Pa 440–622

Wind speed2.00 m/s 0.8–2.20

Cloud cover30.0 % 28.8–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)