Laccaria ochropurpurea

(Berk.) Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hydnangiaceae/Laccaria

At a glance

Occurrence records2 856

Data sources9

Biological traits0

DNA specimens7

eDNA detections6

Sources9 archives

Databases and archives Laccaria ochropurpurea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 856 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 856 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Laccaria ochropurpurea is an edible mushroom found under hardwood and conifers east of the Rocky Mountains. The pileus ranges from 4–13 cm wide and the stipe from 5–19 cm long.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Laccaria ochropurpurea has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX652731.1 ↗665 bpUSA · 2023

ACGT

TTGAATAAACCTGATGTGGCTGTTAGCTGGCTTTTTGAAGCATGTGCTCGTCCGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGT …

Laccaria ochropurpurea voucher HUH iNat#184869576 v2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type2 856 records

Wild obs. + sensor2 384

Museum / vouchered472

Range

Area of Occupancy AOO7 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 981≤1 km 346≤10 km 332>10 km 227

1 886 georeferenced · 498 without coordinates

Open the mapobservation + sensor2 384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 13≤1 km 49≤10 km 114>10 km 53

229 georeferenced · 243 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	101
Chicago, US	70
TENN-Flocation not on record	66
Champaign, US	43
Davis and Elkins Collegelocation not on record	24
Durham, US	15
ILLSlocation not on record	15
St. Paul, US	14
Bernard Price Institute for Palaeontological Researchlocation not on record	14
Université de Montréal Biodiversity Centrelocation not on record	11
Toronto, CA	11
Blacksburg, US	10
Durango, MX	9
Chapel Hill, US	9
WTUlocation not on record	8
Ann Arbor, US	8
Pullman, US	7
Acadia Universitylocation not on record	6
Colorado State Universitylocation not on record	6
McWane Science Centerlocation not on record	6
Catholic University of Pekinglocation not on record	5
Cincinnati, US	2
Laramie, US	1
University of the Philippines Los Baños Museum of Natural Historylocation not on record	1
WU-MYClocation not on record	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
FLASlocation not on record	1
National Museums of Kenyalocation not on record	1
Madison, US	1
Clemson, US	1
CA	1
Helsinki, FI	1

33 institutions · 471 of 472 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Laccaria ochropurpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 10.7–10.7

Seasonal swing summer↔winter23.5 °C

Max temp (day)15.5 °C

Min temp (night)5.90 °C

Precipitation103 mm/mo

Air humidity56.9 %

Moisture balance10.2 mm/mo

Vapour deficit630 Pa

Wind speed4.20 m/s

Cloud cover43.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Laccaria ochropurpurea

At a glance

Sources9 archives

At a glance

Record type2 856 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 856 records