Laccaria fraterna

(Sacc.) Pegler · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hydnangiaceae/Laccaria

At a glance

Occurrence records585

Data sources9

Biological traits0

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Laccaria fraterna's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility585 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF585 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Laccaria fraterna is a species of Laccaria from Australia growing in Eucalyptus and Acacia introduced into the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Laccaria fraterna has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences8

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAJ699072.1 ↗536 bpIndia

ACGT

ACGAGTTTTGAAACGAGTTGTAGCTGGCCTTTCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGG …

Laccaria fraterna ITS1, 5.8S rRNA gene and ITS2, strain 9U

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type585 records

Wild obs. + sensor464

Museum / vouchered120

Other1

Range

Area of Occupancy AOO1 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 207≤1 km 46≤10 km 110>10 km 21

384 georeferenced · 80 without coordinates

Open the mapobservation + sensor464

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 7≤1 km 31≤10 km 5>10 km 2

45 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	21
Kew, GB	14
JA-CAGPDS-CAMlocation not on record	10
Auckland, NZ	9
Chicago, US	9
Copenhagen, DK	8
National Museums of Kenyalocation not on record	5
TROMlocation not on record	4
Olocation not on record	4
BDBClocation not on record	4
Kensington, AU	3
Karlsruhe, DE	3
Museo Entomologico de Leonlocation not on record	2
Philadelphia, US	2
Leicester, GB	2
LDlocation not on record	2
GJOlocation not on record	1
Gijón, ES	1
MUSE - Museo delle Scienze di Trentolocation not on record	1
TFC Miclocation not on record	1
University of the Basque Country (UPV/EHU)location not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	1
IPA/SPlocation not on record	1
Santa Cruz, US	1
WU-MYClocation not on record	1

26 institutions · 112 of 120 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Laccaria fraterna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 11.0–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 15.7–30.5

Min temp (night)19.3 °C 5.00–19.3

Precipitation109 mm/mo 109–181

Air humidity52.0 % 52.0–61.8

Moisture balance-17.8 mm/mo -17.8–62.0

Vapour deficit1,616 Pa 620–1,616

Wind speed1.80 m/s 1.80–5.10

Cloud cover25.2 % 25.2–35.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)