Labrus viridis

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Labridae/Labrus

At a glance

Occurrence records2 029

Data sources11

Biological traits0

DNA specimens13

eDNA detections1

Sources11 archives

Databases and archives Labrus viridis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 804 records↗

OBISOcean Biodiversity Information System225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS2 029 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · NCBI≈709 Mbp

01Narrative

Labrus viridis, communément appelé Labre vert, est une espèce de poissons de la famille des Labridae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Labrus viridis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

257Amostly conserved

299Gmostly conserved

TCCGAGCAGAACTTAGCCAACCAGGGGCCCTCCTCGGAGATGACCAAATTTATAACGTAATCGTCACGGCACATGCGTTCGTAATAATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes3

BIN1

Most divergent pair0.33%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Labrus bergyltasame genus1.8%Labrus mixtussame genus12.6%Prionurus maculatussame order14.8%Ctenolabrus rupestrissame family15.2%Occella dodecaedronsame order15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Labrus viridis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈708 860 492 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Labrus viridis0.71 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 029 records

Wild obs. + sensor1 672

Museum / vouchered195

Other162

Origin

Native706

Range

Area of Occupancy AOO2 624 km²

Depth

0–200 m sunlit102

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.6 m · max 57 m · 102 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 117≤1 km 642≤10 km 89>10 km 224

1 072 georeferenced · 600 without coordinates

Open the mapobservation + sensor1 672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 49≤10 km 5>10 km 4

58 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	49
Frankfurt am Main	9
	4
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
Cambridge, US	2
Stockholm, SE	2
ICM-CSIClocation not on record	1
FishBaselocation not on record	1
CASlocation not on record	1
Helsinki, FI	1
Geneva, CH	1
Barcelona, ES	1
Chicago, US	1
MZLUlocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

15 institutions · 78 of 195 vouchered records shown · 10 without an institution code

09Environmental DNA1 detections

Where the DNA of Labrus viridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Labrus viridis

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 029 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 029 records