Labrisomus philippii

(Steindachner, 1866) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Labrisomidae/Labrisomus

At a glance

Occurrence records377

Data sources9

Biological traits7

DNA specimens10

eDNA detections9

Sources9 archives

Databases and archives Labrisomus philippii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

OBISOcean Biodiversity Information System43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS377 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Labrisomus philippii, the Chalaco clinid, is a species of labrisomid blenny native to the Pacific coast of South America from Peru to Chile. This species can reach a length of 35 cm TL and the greatest recorded weight for a specimen of this fish was 635 g. The identity of the person honoured by Steindachner in the specific name of this fish is unknown but it is thought to be one of the Chilean family of naturalists, the Philippis, Rodolfo Amando Philippi (1808-1904), the German-Chilean paleontologist and zoologist, his brother Bernhard Eunom Philippi (1811-1852) or Rudolfo's son, Federico Philippi (1838-1910).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length36.9 cm

Body mass635 g

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max5 m

Vulnerability26.9

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Labrisomus philippii has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

202Gmostly conserved

217Cmostly conserved

276Tmostly conserved

298Cvariable

CCTTTACTTAATCTTTGGTGCCTGAGCCGGGATAGTCGGCACTGCTCTCAGCTTGTTAATTCGAGCGGAGCTTAGCCAACCCGGTGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Labrisomus xantisame genus9.8%Labrisomus multiporosussame genus11.2%Labrisomus cricotasame genus14.0%Bathylagus euryopssame order15.7%Bathylagus pacificussame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type377 records

Wild obs. + sensor291

Museum / vouchered86

Origin

Native1

Range

Area of Occupancy AOO272 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 3 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 11≤1 km 18≤10 km 3

32 georeferenced · 259 without coordinates

Open the mapobservation + sensor291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 3≤10 km 19>10 km 4

26 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	14
CASlocation not on record	6
Paris, FR	5
New Haven, US	3
University of California San Diegolocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Vancouver, CA	2
Cambridge, US	1
Montgomery, US	1
South Kensington, GB	1
Universidad de Concepcionlocation not on record	1
UNICAMPlocation not on record	1
Los Angeles, US	1

13 institutions · 41 of 86 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Labrisomus philippii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Marine coastal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 17.4–20.6

Seasonal swing summer↔winter6.10 °C

Max temp (day)21.4 °C 20.8–23.2

Min temp (night)16.2 °C 14.6–19.0

Precipitation2.90 mm/mo 2.70–3.50

Air humidity63.7 % 63.3–68.4

Moisture balance-83.5 mm/mo -112–-79.1

Vapour deficit761 Pa 730–767

Wind speed1.40 m/s 1.30–3.00

Cloud cover36.5 % 32.6–55.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)