Laboulbenia slackensis — The Life Data

Fungi/Ascomycota/Laboulbeniomycetes/Laboulbeniales/Laboulbeniaceae/Laboulbenia

At a glance

Occurrence records38

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Laboulbenia slackensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility38 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

DNA & barcodingNCBIsequences

01Narrative

Generalized life cycle of a Laboulbenia fungus. L. slackensis follows the stages of this life cycle, including the development of a sticky ascospore and a foot cell to anchor itself to the host. Laboulbenia slackensis is a microscopic fungus found on Carabidae arthropods. Like all fungi found in the Laboulbeniomycetes class, L. slackensis is an obligate ectoparasite and lives its entire life cycle on one host. It is differentiated from other related species based on host preference, and is studied as an example of speciation due to ecological niche preference.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Laboulbenia slackensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP626242.1 ↗425 bpBelgium · 2019

ACGT

GCGAAACGCGATAGGTAATGTGAATTGCAGAACCCAGTGAATCATCGAATCTTTGAACGCACATTGCACCCCTTGGCAATCCATCGGGTA …

Laboulbenia slackensis isolate D. Haelew. 4128a (ADK6288) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor14

Museum / vouchered22

Other2

Origin

Native14

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 14

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BDBClocation not on record	11
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2

2 institutions · 13 of 22 vouchered records shown · 9 without an institution code