Kunzea ciliata

Toelken · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Kunzea

At a glance

Occurrence records26

Data sources7

Biological traits22

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Kunzea ciliata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF26 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Kunzea ciliata is a flowering plant in the myrtle family, Myrtaceae and is endemic to the south-west of Western Australia. It is a spreading shrub which typically grows to a height of 0.8 to and blooms between October and November producing pink flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length4.3 mm

Leaf width1.45 mm

Plant height1.5 m

Plant height max2.5 m

Plant height min0.7 m

Life cycle & reproduction5

Flowering timennnnnnnnnyyn

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kunzea ciliata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU833158.1 ↗560 bpAustralia

ACGT

CCGGTTAAAAACTCGACGAGGCACGACGGGTCTCGGCCCGAACGCCCTCGAACACGCCTTGGGATCGCGCGGGCGCCTCGTGTGCTCGAG …

Kunzea ciliata voucher H.R. Toelken W886626, AD internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor8

Museum / vouchered18

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 3 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤1 km 1≤10 km 9

12 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	13
Museo Entomologico de Leonlocation not on record	3
Canberra, AU	2

3 institutions · 18 of 18 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Kunzea ciliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)