Kunzea capitata

(Sm.) Heynh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Kunzea

At a glance

Occurrence records2 119

Data sources8

Biological traits46

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Kunzea capitata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Occurrence & distributionGBIF2 119 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

كونزية رؤيسية هي نوع من النباتات تتبع جنس الكونزية من فصيلة الآسية. تم وصف هذا النوع من النبات علمياً لأول مرة من قبل جيمس إدوارد سميث وHeynh. سنة 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length3.75 mm

Fruit width2.25 mm

Leaf length8 mm

Leaf length max9 mm

Leaf length min3.5 mm

Leaf mass per area141 g/m2

Leaf size10 mm²

Leaf width3.5 mm

Leaf width max4.5 mm

Leaf width min1.5 mm

Petiole length0.1 cm

Plant height2 m

Plant height max2 m

Seed mass0.04 mg

⚠ sources differ — TRY: 0.04 mg · AusTraits: 0.062 mg · GIFT: 0.044 mg

Seed mass max0.058 mg

Seed mass min0.03 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeself

Flowering timennnnnnnyyyyn

Life formshrub

Life spanperennial

Lifespan years60 years

⚠ sources differ — TRY: 60 years · AusTraits: 45 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_ovate oblong

Mycorrhiza type0.039598359

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio35.7 g/g

Leaf c503 mg/g

Leaf n14.1 mg/g

Leaf p0.24 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.94 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kunzea capitata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU833156.1 ↗558 bpAustralia

ACGT

CCGGTTAAAAACTCGATGAGGATGGCGGGTCTCGGCCCGACGTCCCTCGACACGCCCTGGGATCGCGCGGGCGCCTCGTGCGCTCGAGCG …

Kunzea capitata voucher H.R. Toelken W862949, AD internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kunzea capitata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1948a

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 119 records

Wild obs. + sensor1 960

Museum / vouchered155

Cultivated / captive3

Other1

Origin

Native15

Range

Area of Occupancy AOO2 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 366≤1 km 271≤10 km 118>10 km 19

1 774 georeferenced · 186 without coordinates

Open the mapobservation + sensor1 960

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 22≤1 km 47≤10 km 37>10 km 9

115 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence155

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Armidale, AU	34
Canberra, AU	26
Museo Entomologico de Leonlocation not on record	22
Wollongong, AU	19
Mount Annan, AU	13
Adelaide, AU	8
Hobart, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	5
John T. Waterhouse Herbariumlocation not on record	5
Brisbane, AU	4
Kew, GB	3
Batemans Bay, AU	3
Auckland, NZ	2
Zürich, CH	1
GJOlocation not on record	1
Madison, US	1

16 institutions · 153 of 155 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Kunzea capitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Kunzea capitata

At a glance

Sources8 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment11

Physiology & chemistry7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 119 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 119 records