Kunzea ambigua

(Sm.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Kunzea

At a glance

Occurrence records8 413

Data sources11

Biological traits46

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Kunzea ambigua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Chemical compositionLOTUS · NPASS94 compounds

Occurrence & distributionGBIF8 413 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Kunzea ambigua, connue parfois sous le nom de Kunzea blanche, est une espèce de plantes à fleurs de la famille des Myrtaceae. C'est un arbuste poussant sur les sols gréseux de l'est de l'Australie qui peut atteindre 5 m de hauteur sur autant de largeur. Il porte de petites fleurs blanches au printemps. Dans les jardins, Kunzea ambigua attire les insectes. Il est également utilisé dans les plantations pour la stabilisation des dunes de sable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length3 mm

Fruit width3.5 mm

Leaf length12 mm

Leaf length max12 mm

Leaf length min4 mm

Leaf size14.14 mm²

Leaf width1.5 mm

Leaf width max1.5 mm

Leaf width min1 mm

Petiole length0.05 cm

Plant height4 m

Plant height max4 m

Plant height min2 m

Seed mass0.03 mg

⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.024 mg · GIFT: 0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnnyyy

Life formshrub

Life spanperennial

Lifespan years27.5 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio41.27 g/g

Leaf c504 mg/g

Leaf n12.2 mg/g

Leaf p0.48 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.51 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition94 compounds

Compounds documented for Kunzea ambigua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chromones26

Flavonols16

Gallotannins9

Acyl phloroglucinols8

Flavanones5

Documented compounds94 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,4aR,7S,7aR,7bR)-1,1-dimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[h]azulen-7-ol	present	LOTUS
(1aR,4aR,7S,7aS,7bR)-1,1,7-Trimethyl-4-methylidenedecahydro-1H-cyclopropa[e]azulen-7-ol	present	LOTUS
(1aR,4R,4aR,7R,7aR,7bS)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-ol	present	LOTUS
(1R,2S,4S,7R,9R,12S,13R)-3,3,7,12,16,16,18,18-octamethyl-13-(2-methylpropyl)-8,20-dioxapentacyclo[10.8.0.02,4.07,9.014,19]icos-14(19)-ene-15,17-dione	present	LOTUS
(1S,2S,4S,7R,9R,12S,13R)-3,3,7,12,16,16,18,18-octamethyl-13-(2-methylpropyl)-8,20-dioxapentacyclo[10.8.0.02,4.07,9.014,19]icos-14(19)-ene-15,17-dione	present	LOTUS
(2R)-1-[2-hydroxy-3,5-dimethyl-4,6-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]phenyl]-2-methylbutan-1-one	present	LOTUS
(2R)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S)-1-[2,4-dihydroxy-3-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2-methylbutan-1-one	present	LOTUS
(2S)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
(2S,6R)-5-hydroxy-8,8,10,10,12-pentamethyl-6-(2-methylpropyl)-2-phenyl-3,6-dihydro-2H-chromeno[3,2-g]chromene-4,7,9-trione	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kunzea ambigua has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU833173.1 ↗558 bpAustralia

ACGT

CCGGTTAAAAACTCGACGAGGATGGTGGGTCTCGGCCCGACGTCCCTCGACACGCCCTGTGATCGCGCGGGCGCCTCGTGCGCTCGAGCG …

Kunzea pelagia voucher H.R. Toelken s.n., AD internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kunzea ambigua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1948a

CCDB · book-atlas-flowering-plants — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 413 records

Wild obs. + sensor7 629

Museum / vouchered776

Cultivated / captive7

Other1

Origin

Native229

Introduced10

Range

Area of Occupancy AOO9 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 5 755≤1 km 1 157≤10 km 255>10 km 48

7 215 georeferenced · 414 without coordinates

Open the mapobservation + sensor7 629

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 102≤1 km 213≤10 km 322>10 km 44

681 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence776

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 3 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	230
Museo Entomologico de Leonlocation not on record	139
Hobart, AU	124
Canberra, AU	120
Adelaide, AU	24
Armidale, AU	15
Brisbane, AU	15
Batemans Bay, AU	14
QVMAGlocation not on record	14
Wollongong, AU	14
NSW Dept of Planning, Industry and Environmentlocation not on record	13
Auckland, NZ	8
John T. Waterhouse Herbariumlocation not on record	7
Parkville, AU	7
Kew, GB	6
Kensington, AU	6
Rotorua, NZ	4
Wellington, NZ	3
Smithfield, AU	2
La Trobe Universitylocation not on record	2
Canadian Department of Agriculturelocation not on record	1
Christchurch, NZ	1
Cambridge University Herbariumlocation not on record	1
Stockholm, SE	1
Bronx, US	1
Wuzhou, CN	1

26 institutions · 773 of 776 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Kunzea ambigua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Kunzea ambigua

At a glance

Sources11 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Other traits1

Compound class profile5 classes

Documented compounds94 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 413 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type8 413 records