Kunugia undans

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lasiocampidae/Kunugia

At a glance

Occurrence records251

Data sources7

Biological traits0

DNA specimens24

eDNA detections16

Sources7 archives

Databases and archives Kunugia undans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF251 records

Environmental DNA1 datasets · 3 countries16 detections

DNA & barcodingBOLD24 specimens

01Narrative

Kunugia undans is a species of moth in the family Lasiocampidae. It is found in Russia, Japan, China, Taiwan, Vietnam, South Korea, Bhutan. The wingspan is 58–105 mm. Adults are on wing in September in Taiwan.Oriental Butterflies and Moths The larvae feed on Ardisia sieboldii and Barringtonia racemosa.digimuse

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kunugia undans has left across the world's sequence archives.

At a glance

DNA specimens24

BINs4

Marker genes1

eDNA detections16

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

7Avariable

31Cmostly conserved

79Gmostly conserved

86Amostly conserved

87Amostly conserved

88Cmostly conserved

100Avariable

127Tmostly conserved

169Amostly conserved

181Amostly conserved

200Gmostly conserved

212Cmostly conserved

291Cvariable

294Tvariable

295Amostly conserved

340Cmostly conserved

343Cvariable

349Amostly conserved

352Tmostly conserved

364Tmostly conserved

368Avariable

370Amostly conserved

373Amostly conserved

385Tmostly conserved

412Gmostly conserved

415Amostly conserved

433Amostly conserved

466Gvariable

514Amostly conserved

517Gmostly conserved

523Tmostly conserved

532Tmostly conserved

538Tmostly conserved

547Cmostly conserved

548Cmostly conserved

553Tmostly conserved

557Cmostly conserved

559Tmostly conserved

571Tmostly conserved

610Cmostly conserved

616Cmostly conserved

625Avariable

628Gvariable

637Cmostly conserved

641Cmostly conserved

643Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGAACCTCTCTAAGATTATTAATTCGCGCTGAATTAGGGACCCCTAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes12

BINs4

Most divergent pair5.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kunugia basinigrasame genus6.2%Kunugia placidasame genus7.3%Kunugia lineatasame genus7.4%Kunugia burmensissame genus7.9%Dendrolimus angulatasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type251 records

Wild obs. + sensor124

Museum / vouchered127

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 54≤1 km 25≤10 km 4>10 km 7

90 georeferenced · 34 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 23≤1 km 14

37 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sam Noble Oklahoma Museum of Natural Historylocation not on record	35
Hiwa Museum of Natural Historylocation not on record	22
Tartu, EE	15
Tomioka, JP	9
Gifu prefectural Museumlocation not on record	9
Philadelphia, US	8
JP	7
KOMlocation not on record	5
Toyota city nature sanctuarylocation not on record	4
Iwate Prefectural Museumlocation not on record	2
Chiba, JP	2
Shiojiri City Museum of Natural Historylocation not on record	2
NSMKlocation not on record	2
Toyama, JP	1
Sagamihara, JP	1
RCMlocation not on record	1
Bando, JP	1
Uniwersytet Łódzkilocation not on record	1

18 institutions · 127 of 127 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Kunugia undans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map3 countries0

Subtropical forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 12.7–21.6

Seasonal swing summer↔winter18.1 °C

Max temp (day)24.4 °C 15.6–25.0

Min temp (night)15.2 °C 8.50–17.6

Precipitation140 mm/mo 66.2–189

Air humidity59.5 % 59.3–66.8

Moisture balance46.8 mm/mo -49.9–96.4

Vapour deficit849 Pa 577–1,025

Wind speed2.10 m/s 1.30–2.90

Cloud cover37.4 % 28.7–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)