Kundmannia sicula

(L.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Kundmannia

At a glance

Occurrence records697

Data sources9

Biological traits13

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Kundmannia sicula's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility697 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF697 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Kundmannia sicula is a species of perennial herb in the family Apiaceae. They have a self-supporting growth form and have broad leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.93 mg

⚠ sources differ — TRY: 4.93 mg · GIFT: 5.21 mg

Seed mass max5.21 mg

Seed mass min5.21 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Kundmannia sicula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
alpha-Muurolene		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kundmannia sicula has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP467552.1 ↗602 bpSpain · 1917

ACGT

TCGATCCTGCGATAGCAGAAAGACCCGCTAACTCGTAAAAACATCGGGCAAGCTCACGGGGATTTCGTTCCCTGTTAGTGAACCCTTGGT …

Kundmannia sicula voucher P03673562 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kundmannia sicula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2214×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +5

CCDB · ita-fl — BARTOLO G., BRULLO S., GRILLO M., PAVONE P., ZIZZA A. - 1978. Numeri cromosomici per la flora italiana:382-397.. Inform. Bot. Ital. , 10(1): 64-80.

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Nilsson, O. & P. Lassen.Bot. Not.124: 270-276(1971).

CCDB · iber-fl — Contribuiao para o estudo cariolgico da familia Umbelliferae. I Gard, A. & N. Malheiros-Gard.Agron. Lusit.11(2): 91-140(1949).

CCDB · ipcn-api-dl — Contandriopoulos, J., D. Noguet & C. Zevaco-Schmitz. 1987. Contribution à l'étude de quelques espèces interessantes de Corse: cytotaxonomie et comportement écologique. Biol.-Ecol. Medit. 10: 259–271.

CCDB · ipcn-api-dl — Bartolo, G., S. Brullo & P. PAVONE. 1978. Numeri cromosomici per la flora Italiana: 484-493. Inform. Bot. Ital. 10: 267–277.

CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I

CCDB · book-fedorov — Garde, Malheiros-Garde 1949

CCDB · book-atlas-flowering-plants — Garde & G. 1949

CCDB · CromoCat 2015 — Bartolo, G., S. Brullo, M. Grillo, P. Pavone & A. Zizza. (1978b). Numeri cromosomatici per la Flora Italiana: 382-397. Inf. Bot. Ital. 10: 64-80.

CCDB · CromoCat 2015 — Contandriopoulos, J., Noguet, D. & Zevaco-Schmitz, C. (1987). Contribution à l'étude de quelques espèces interessantes de Corse: cytotaxonomie et comportement écologique. . Biol. & Écol. Médit. 10: 259-271.

CCDB · CromoCat 2015 — Nilsson, Ö. & P. Lassen. (1971). Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Bot. Not. 124(2): 270-276.

CCDB · CromoCat 2015 — Gardé, A. & Malheiros-Gardé, N. (1949). Contribuiçao para o estudo cariológico da familia Umbelliferae. I. Agron. Lusit. 11(2): 91-140.

CCDB · iapt — IAPT/IOPB Chromosome Data 27

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.960 ↗

08Occurrence & distribution

Record type697 records

Wild obs. + sensor494

Museum / vouchered199

Other4

Origin

Native71

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 98≤1 km 88≤10 km 199>10 km 19

404 georeferenced · 90 without coordinates

Open the mapobservation + sensor494

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 5≤1 km 28≤10 km 31

64 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	66
MAlocation not on record	16
BClocation not on record	12
Barcelona, ES	9
UIBlocation not on record	9
Moscow State Universitylocation not on record	8
CJBGlocation not on record	7
Wlocation not on record	7
College of the Atlantic, Museumlocation not on record	7
Sevilla, ES	6
València, ES	6
Berlin, DE	5
Salamanca, ES	5
Alicante, ES	4
LDlocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
JBSlocation not on record	3
BRNUlocation not on record	2
Entomological Society of Latvialocation not on record	2
Madrid, ES	1
Jaén, ES	1
Granada, ES	1
Badajoz, ES	1
CICYTEXlocation not on record	1
ISAlocation not on record	1
Kew, GB	1
Vitoria, ES	1
BDBClocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Pamplona, ES	1

31 institutions · 195 of 199 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)