Kryptolebias marmoratus

(Poey, 1880) · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Rivulidae/Kryptolebias

At a glance

Occurrence records153

Data sources12

Biological traits7

DNA specimens144

eDNA detections93

Sources12 archives

Databases and archives Kryptolebias marmoratus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

OBISOcean Biodiversity Information System14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics144 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS153 records

Environmental DNA1 datasets · 3 countries93 detections

DNA & barcodingBOLD144 specimens

Genome at a glanceGoaT · NCBI≈681 Mbp

01Narrative

The mangrove killifish or mangrove rivulus, Kryptolebias marmoratus (syn. Rivulus marmoratus), is a species of killifish in the family Rivulidae. It lives in brackish and marine waters (less frequently in fresh water) along the coasts of Florida, through the Antilles, and along the eastern and northern Atlantic coasts of Mexico, Central America and South America (south to Brazil). It has a very wide tolerance of both salinity (0—68 ‰)Bester, C: Mangrove Rivulus. Florida Museum. Retrieved 6 May 2017. and temperature (12-38 C),Hill, K: Rivulus marmoratus. Smithsonian Marine Station at Fort Pierce. Retrieved 6 May 2017. can survive for about two months on land, and mostly breeds by self-fertilization. It is typically found in areas with red mangrove and sometimes lives in burrows of Cardisoma guanhumi crabs. The mangrove rivulus is up to 7.5 cm long, but most individuals are 1-3.8 cm. Overall the mangrove rivulus is widespread and not threatened, but in the United States it is considered a Species of Concern by the National Marine Fisheries Service.National Marine Fisheries Service (23 February 2017). Species of Concern List. Retrieved 6 May 2017.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length7.5 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth min0 m

Vulnerability10

05DNA & barcoding144 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kryptolebias marmoratus has left across the world's sequence archives.

At a glance

DNA specimens144

BINs2

Marker genes12

eDNA detections93

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus132 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

4Tvariable

8Cvariable

64Avariable

82Avariable

163Avariable

175Cmostly conserved

178Gvariable

214Gvariable

220Tvariable

268Tvariable

370Gvariable

379Tvariable

394Cmostly conserved

397Gvariable

496Tvariable

508Avariable

514Cvariable

547Gvariable

592Cmostly conserved

601Tvariable

646Gvariable

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTCGGGACTGCCTTAAGCTTGCTTATTCGAGCAGAACTCAGCCAACCAGGGTCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes18

BINs2

Most divergent pair3.5%

N.AmericaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kryptolebias hermaphroditussame genus2.8%Kryptolebias ocellatussame genus10.8%Alestes liebrechtsiisame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_003290 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Kryptolebias marmoratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈680 638 340 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Kryptolebias marmoratus0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.1% BUSCO

07Deep time~4.23 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.23 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type153 records

Wild obs. + sensor41

Museum / vouchered112

Origin

Native2

Range

Area of Occupancy AOO376 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 30 m · max 30 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 3≤10 km 5>10 km 23

31 georeferenced · 10 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 1>10 km 2

6 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	95
Toronto, CA	3
New Haven, US	2
Tapachula, MX	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Vancouver, CA	1
Universidad del Valle (UniValle)location not on record	1

7 institutions · 106 of 112 vouchered records shown · 1 without an institution code

09Environmental DNA93 detections

Where the DNA of Kryptolebias marmoratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 20.2–26.9

Seasonal swing summer↔winter3.80 °C

Max temp (day)27.7 °C 24.7–28.0

Min temp (night)22.8 °C 15.9–25.6

Precipitation107 mm/mo 101–129

Air humidity64.2 % 61.2–66.5

Moisture balance-51.5 mm/mo -69.2–-21.3

Vapour deficit1,255 Pa 833–1,288

Wind speed3.30 m/s 3.10–4.20

Cloud cover27.7 % 20.6–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)