Krigia montana

(Michx.) Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Krigia

At a glance

Occurrence records270

Data sources9

Biological traits7

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Krigia montana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Krigia montana, known as mountain dwarfdandelion, is a North American species of plants in the family Asteraceae. It is native to the Great Smoky Mountains and other nearby peaks in the southern Appalachians of Tennessee, the Carolinas, and Georgia. It is found on cliffs and outcrops at high elevations.Biota of North America Program 2014 county distribution mapFlora of the Southern and Mid-Atlantic States by Alan Weakley Krigia montana is a perennial herb up to 50 cm (20 inches) tall. One plant can produce 20 or more flower heads, each head with 25–60 yellow ray flowers but no disc flowers.Flora of North America, Krigia montana (Michaux) Nuttall, 1818. Mountain dwarf dandelion

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Krigia montana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAY218962.1 ↗635 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACTTGTACCCATAATCGGGAGTCAGGGATATTGGCTCTGCCTTTGTCCCTGACACCCTGT …

Krigia montana clone KRIM internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Krigia montana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

CCDB · ipcn-api-dl — Chinnappa, C. C. 1981. Cytological studies in Krigia (Asteraceae). Canad. J. Genet. Cytol. 23: 67 1 –678.

CCDB · eflora

n 103×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kim, K. J. & B. L. Turner. 1992. Systematic overview of Krigia (Asteraceae---Lactuceae). Brittonia 44(2): 173–198.

CCDB · ipcn-api-dl — Kim, K. J., B. L. Turner & R. K. Jansen. 1992. Phylogenetic and evolutionary implications of interspecific chloroplast DNA variation in Krigia (Asteraceae---Lactuceae). Syst. Bot. 17: 449–469.

CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.048 ↗

08Occurrence & distribution

Record type270 records

Wild obs. + sensor203

Museum / vouchered67

Range

Area of Occupancy AOO484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 125≤1 km 12≤10 km 6>10 km 29

172 georeferenced · 31 without coordinates

Open the mapobservation + sensor203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 4≤1 km 31≤10 km 14>10 km 10

59 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Carolina Universitylocation not on record	29
Chapel Hill, US	12
Bangkok, TH	10
Wuzhou, CN	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Bloomington, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1
University of North Carolina at Pembrokelocation not on record	1
Norfolk, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Mount Berry, US	1
Durham, US	1
Jackson, US	1
Asheville, US	1
Chongqing Museumlocation not on record	1

16 institutions · 67 of 67 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Krigia montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)