Kretania trappi

(Verity, 1927) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Kretania

At a glance

Occurrence records5 261

Data sources7

Biological traits0

DNA specimens10

eDNA detections0

Sources7 archives

Databases and archives Kretania trappi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 261 records↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 261 records

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT≈684 Mbp

01Narrative

The Alpine zephyr blue (Kretania trappi) is a species of butterfly in the family Lycaenidae. It is found in Italy and Switzerland. Its natural habitats are temperate forests and temperate grassland. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kretania trappi has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

235Cvariable

616Tmostly conserved

AACATTATATTTCATCTTTGGAATTTGAGCAGGAATAGTAGGAACATCCCTAAGAATTTTAATTCGTATAGAATTAAGAATTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kretania pylaonsame genus1.5%Kretania eurypilussame genus1.8%Kretania nichollaesame genus2.1%Kretania zephyrinussame genus2.3%Kretania modicasame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Kretania trappi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈683 814 236 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Kretania trappi0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.1% BUSCO

08Occurrence & distribution

Record type5 261 records

Wild obs. + sensor3 946

Museum / vouchered1 315

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 41≤1 km 13≤10 km 3 801>10 km 85

3 940 georeferenced · 6 without coordinates

Open the mapobservation + sensor3 946

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤100 m 1≤1 km 5≤10 km 1 168>10 km 137

1 311 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence1 315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	511
Paro, BT	333
Zürich, CH	81
Geneva, CH	75
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	60
Musee d'Histoire Naturallelocation not on record	35
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	27
Museum zu Allerheiligen Schaffhausenlocation not on record	26
Sion, CH	21
Glarus, CH	15
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
Winterthur, CH	5
CASMlocation not on record	2
Natural History Museum of Neuchatellocation not on record	1

14 institutions · 1 200 of 1 315 vouchered records shown · 115 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Kretania trappi

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 261 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 14 geolocated

Record type5 261 records