Kraussillichirus kraussi

(Stebbing, 1900) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Callichiridae/Kraussillichirus

At a glance

Occurrence records108

Data sources6

Biological traits3

DNA specimens496

eDNA detections493

Sources6 archives

Databases and archives Kraussillichirus kraussi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

OBISOcean Biodiversity Information System48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI493 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics496 specimens↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS108 records

Environmental DNA1 datasets · 1 countries493 detections

DNA & barcodingBOLD496 specimens

01Narrative

Kraussillichirus kraussi (Stebbing, 1900), commonly named the common sandprawn or pink prawn, is a species of ghost shrimp, an African crustacean in the family Callianassidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding496 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kraussillichirus kraussi has left across the world's sequence archives.

At a glance

DNA specimens496

BINs2

Marker genes2

eDNA detections493

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus317 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

60Gvariable

112Cmostly conserved

315Avariable

386Gvariable

AGTTTAATTGGCGATGATCAAATTTATAATGTAATTGTGACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTTATACCAATTATGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes18

BIN1

Most divergent pair1.4%

OtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neocallichirus calmanisame order16.0%Boreomysis arcticasame order17.2%Coenobita violascenssame order17.4%Procambarus zonangulussame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type108 records

Wild obs. + sensor94

Museum / vouchered14

Range

Area of Occupancy AOO252 km²

Depth

0–200 m sunlit21

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 122 m · max 142 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 38≤1 km 11>10 km 1

50 georeferenced · 44 without coordinates

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Johannesburglocation not on record	2
Oceanographic Research Institutelocation not on record	1

2 institutions · 3 of 14 vouchered records shown

09Environmental DNA493 detections

Where the DNA of Kraussillichirus kraussi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found493

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 493 detections have coordinates

Open the map1 country0

rocky shoreMangrove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.7–24.8

Seasonal swing summer↔winter6.40 °C

Max temp (day)17.8 °C 17.4–26.2

Min temp (night)14.1 °C 14.1–22.9

Precipitation113 mm/mo 39.0–130

Air humidity61.6 % 61.5–62.8

Moisture balance18.6 mm/mo

Vapour deficit687 Pa 682–1,157

Wind speed6.50 m/s

Cloud cover13.9 % 12.6–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)