Kraussia floribunda

Harv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Kraussia

At a glance

Occurrence records460

Data sources10

Biological traits27

DNA specimens15

eDNA detections11

Sources10 archives

Databases and archives Kraussia floribunda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF460 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI15 specimens

01Narrative

Kraussia floribunda is a species of plant in the family Rubiaceae. It ranges from Mozambique and Eswatini to eastern South Africa, and is associated with the Tongoland-Pondoland regional mosaic. The type was described from a plant collected by Dr. F. Krauss near Durban.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf size7 025 mm²

Plant height4 m

⚠ sources differ — GIFT: 4 m · TRY: 6 m

Plant height max4 m

Plant height min0.6 m

Seed mass119 mg

Seed mass max119 mg

Seed mass min119 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max800 m

Elevation min5 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: tree

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio28.0 g/g

Leaf c462 mg/g

Leaf n18.47 mg/g

Leaf p1.33 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7.72 mm²/mg

Wood density650 mg/cm³

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kraussia floribunda has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences10

eDNA detections11

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX572708.1 ↗552 bpSouth Africa · 2006

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Kraussia floribunda voucher OM1180 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★rbcLa★trnL

plant barcode

08Occurrence & distribution

Record type460 records

Wild obs. + sensor232

Museum / vouchered228

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 136≤1 km 47≤10 km 12

195 georeferenced · 37 without coordinates

Open the mapobservation + sensor232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	149
Durban, ZA	15
MeiseBGlocation not on record	13
Instituto de Investigação Científica Tropicallocation not on record	9
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	4
Kew, GB	2
MSB-3054location not on record	2
Stockholm, SE	1
South African National Biodiversity Institutelocation not on record	1
Uppsala, SE	1
South Kensington, GB	1

11 institutions · 198 of 228 vouchered records shown · 30 without an institution code

09Environmental DNA11 detections

Where the DNA of Kraussia floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 20.5–24.4

Seasonal swing summer↔winter8.40 °C

Max temp (day)27.9 °C 26.6–29.4

Min temp (night)15.8 °C 14.5–19.0

Precipitation16.4 mm/mo 13.5–80.7

Air humidity54.6 % 53.6–57.5

Moisture balance-95.2 mm/mo -118–-63.2

Vapour deficit1,224 Pa 1,094–1,317

Wind speed3.40 m/s 2.70–4.10

Cloud cover17.0 % 13.8–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)