Krananda latimarginaria

Leech, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Krananda

At a glance

Occurrence records1 497

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Krananda latimarginaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 497 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Trigonoptila latimarginaria is a moth of the family Geometridae first described by John Henry Leech in 1891. It is found in Japan, the Korean Peninsula, Taiwan and China. The wingspan is 33–40 mm. There are five generations per year. The larvae feed on Cinnamomum species and are considered a serious pest in China.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Krananda latimarginaria has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

502Amostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psilalcis bretasame family6.5%Selidosema plumariasame family6.7%Peribatodes perversariasame family6.8%Metabraxas corynetasame family6.8%Arichanna undulariasame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 497 records

Wild obs. + sensor1 364

Museum / vouchered133

Range

Area of Occupancy AOO2 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 254≤1 km 160≤10 km 28>10 km 59

501 georeferenced · 863 without coordinates

Open the mapobservation + sensor1 364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	69
Kawasaki Shi Tama Ku, JP	33
Chiba, JP	18
ZSMlocation not on record	5
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	3
Sagamihara, JP	3
Toyota city nature sanctuarylocation not on record	1
National Institute for Agro-Environmental Scienceslocation not on record	1

8 institutions · 133 of 133 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Krananda latimarginaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Subtropical forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 10.6–20.5

Seasonal swing summer↔winter14.2 °C

Max temp (day)21.3 °C 14.0–22.8

Min temp (night)14.9 °C 6.90–18.0

Precipitation349 mm/mo 82.1–508

Air humidity68.4 % 61.5–73.3

Moisture balance235 mm/mo 30.2–373

Vapour deficit642 Pa 469–737

Wind speed1.90 m/s 1.70–2.10

Cloud cover56.3 % 46.6–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Krananda latimarginaria

At a glance

Sources8 archives

At a glance

Record type1 497 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 497 records