Krameria cistoidea

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Zygophyllales/Krameriaceae/Krameria

At a glance

Occurrence records403

Data sources8

Biological traits14

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Krameria cistoidea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF403 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Krameria cistoidea is a perennial shrub in the plant family Krameriaceae. The biological action of genus members is caused by the astringent rhataniatannic acid, which is similar to tannic acid. Members of Krameria are found across the Americas, with most native to the tropical regions. An example occurrence is in the Cerro La Campana of central Chile, where it is found in association with the Chilean Wine Palm, Jubaea chilensis.C. Michael Hogan. 2008 They are perennial shrubs which act as root parasites on other plants. The flowers have glands called elaiophoresB.B. Simpson. 1982 which produce a lipid which is collected by bees of the genus Centris as they pollinate the flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass232 mg

Seed mass max247 mg

Seed mass min211 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Krameria cistoidea has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences5

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAY261016.1 ↗568 bp

ACGT

ATAATGACATGAGAATGTTTGTTCTTCTCGGAGGTGCAACATGCGGGTTGTCCCGTCGTTGGCTCCATGGGCCAGGGGTTGTGGTGGCAT …

Krameria cistoidea isolate 55 clone 05 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type403 records

Wild obs. + sensor284

Museum / vouchered118

Fossil1

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 92≤1 km 22≤10 km 10>10 km 10

134 georeferenced · 150 without coordinates

Open the mapobservation + sensor284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 118 records without

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Herbario Universidad de Concepciónlocation not on record	78
Valparaiso, CL	10
Chicago, US	6
UChlocation not on record	5
Saint Louis, US	5
Edinburgh, GB	3
PARTICULARlocation not on record	2
MeiseBGlocation not on record	2
Northridge, US	1
Uniwersytet Jagiellońskilocation not on record	1
MAlocation not on record	1
Kew, GB	1
ASUlocation not on record	1
Austin, US	1
UNESP-FCAlocation not on record	1

15 institutions · 118 of 118 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Krameria cistoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)