Koruthaialos sindu — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Koruthaialos

At a glance

Occurrence records111

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Koruthaialos sindu's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility111 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF111 records

DNA & barcodingBOLD5 specimens

01Narrative

Koruthaialos sindu, the bright red velvet bob, is a butterfly belonging to the family Hesperiidae. The species was first described by father and son entomologists Cajetan and Rudolf Felder in 1860.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Koruthaialos sindu has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATACTTTATTTTTGGAATTTGAGCAGGCTTACTAGGAACTTCTTTAAGATTATTAATTCGTACTGAATTAGGAAATCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Koruthaialos butlerisame genus7.3%Koruthaialos rubeculasame genus7.8%Ocybadistes ardeasame family9.3%Dalla vincasame family9.3%Acleros mackeniisame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor111

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 35≤1 km 30≤10 km 11>10 km 21

97 georeferenced · 14 without coordinates

Open the mapobservation + sensor111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.