Korthalsella rubra

(Tiegh.) Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Viscaceae/Korthalsella

At a glance

Occurrence records47

Data sources7

Biological traits27

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Korthalsella rubra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Korthalsella rubra é uma planta pertencente à família Santalaceae (sândalo), anteriormente colocada nas Viscaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length1 mm

Fruit width1 mm

Leaf length10 mm

Leaf width3 mm

Plant height0.16 m

Plant height max0.16 m

Plant height min0.1 m

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnnnnn

Life formhemiparasitic epiphyte

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Korthalsella rubra has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSJF950772.1 ↗653 bp

ACGT

ATCATTGTTGAAGCTTTTGCCCAACGTGGAATGACCTGGGAACATGTTGAACATGAGGGCGAGGTGACTGGACATGGGATGGTCCAGCTT …

Korthalsella rubra voucher NSW:786344 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor44

Museum / vouchered1

Other2

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 21≤10 km 3>10 km 3

27 georeferenced · 17 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA3 detections

Where the DNA of Korthalsella rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)