Korthalsella leucothrix

Barlow · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Viscaceae/Korthalsella

At a glance

Occurrence records34

Data sources4

Biological traits19

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Korthalsella leucothrix's data was compiled from.

GBIFGlobal Biodiversity Information Facility34 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF34 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Leaf length15 mm

Leaf width3.5 mm

Plant height0.09 m

Life cycle & reproduction6

Dispersal typeself

Flowering timennnnnnnynnnn

Life formhemiparasitic epiphyte

Life spanperennial

Pollination syndromeinsect

Sex typemonoecious

Diet & foraging1

Parasiteobligatory

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb · TRY: herb

Leaf compoundnesssimple

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Korthalsella leucothrix has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMK497810.1 ↗624 bp

ACGT

TTGAAGCTTTTGCCCAACGCGGACGACCCGGGAACACGTTGAACATGTGGGCGAGGTGGACAGGGATGGGATGGCCTAGCCTCTGCCCCG …

Korthalsella leucothrix voucher D. J. Edinger & al. DJE2479A (PERTH 05853818) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type34 records

Wild obs. + sensor4

Museum / vouchered30

Origin

Native4

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 2≤10 km 25>10 km 1

30 georeferenced

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	14
Kensington, AU	12
Canberra, AU	2
Mount Annan, AU	1

4 institutions · 29 of 30 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)