Kordyana brasiliensis — The Life Data

Fungi/Basidiomycota/Exobasidiomycetes/Exobasidiales/Brachybasidiaceae/Kordyana

At a glance

Occurrence records793

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Kordyana brasiliensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility793 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF793 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kordyana brasiliensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR614367.1 ↗574 bpAustralia · 2020

ACGT

GTAAAAGTCATAACAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAATAAAAGGGCTTTGAATTCGTTCGGCCCGTTTCTT …

Kordyana brasiliensis isolate KBY2.Y small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type793 records

Wild obs. + sensor791

Museum / vouchered2

Range

Area of Occupancy AOO1 348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 529≤1 km 26≤10 km 9>10 km 8

572 georeferenced · 219 without coordinates

Open the mapobservation + sensor791

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	2

1 institutions · 2 of 2 vouchered records shown