Kopsia singapurensis

Ridl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Kopsia

At a glance

Occurrence records69

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Kopsia singapurensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS · NPASS105 compounds

Occurrence & distributionGBIF69 records

DNA & barcodingNCBIsequences

01Narrative

Kopsia singapurensis (also called white kopsia) is a species of plant in the family Apocynaceae. It is native to Peninsular Malaysia and Singapore. It is threatened by habitat loss. It can grow up to five metres tall. When the plant is cut, white latex is produced. The flower has five petals. In Singapore, the tree can only be found in the Nee Soon Swamp Forest. In the wild, it flowers only twice a year, but when cultivated, it is free-flowering if grown under the right conditions.Middleton, D.J. (2004). A Revision of Kopsia (Apocynaceae: Rauvolfioideae). Harvard Papers in Botany 9: 89-142.Middleton, D.J. (2007). Apocynaceae (subfamilies Rauvolfioideae and Apocynoideae). Flora Malesiana 18: 1-474. Noordhoff-Kolff N.V., Djakarta.Middleton, D.J. (2011). Flora of peninsular Malaysia , II, 2: 1-235. Institut Penyelidikan Perhutanan Malaysia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

03Chemical composition105 compounds

Compounds documented for Kopsia singapurensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma type76

Corynanthe type29

Corynanthe type $ Yohimbine-like alkaloids1

Aspidosperma type $ Corynanthe type1

Corynanthe type $ Strychnos type1

Documented compounds105 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Venalstonine	present	LOTUS
(12R,19R)-12-ethyl-8,16-diazatetracyclo[10.6.1.02,7.016,19]nonadeca-1(18),2,4,6-tetraen-9-one	present	LOTUS
(12S,19R)-12-ethyl-19-hydroxy-8,16-diazatetracyclo[10.6.1.02,7.016,19]nonadeca-1(18),2,4,6-tetraene-9,17-dione	present	LOTUS
(1S,12R,13R,16S,23S)-12-hydroxy-11,12-bis(methoxycarbonyl)-6,8-dioxa-11,20-diazahexacyclo[14.6.1.01,13.02,10.05,9.020,23]tricosa-2(10),3,5(9),17-tetraene-16-carboxylic acid	present	LOTUS
(1S,9R,10R,13S,20S)-9-hydroxy-6-methoxy-8,9-bis(methoxycarbonyl)-8,17-diazapentacyclo[11.6.1.01,10.02,7.017,20]icosa-2(7),3,5,14-tetraene-13-carboxylic acid	present	LOTUS
(1S,9R,15S,16S,17S,18R,21R)-15,17,18-trihydroxy-18-methoxycarbonyl-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3,5,7-triene-2-carboxylic acid	present	LOTUS
(5R,17S)-5-ethyl-17-hydroxy-1,9-diazatetracyclo[8.6.1.05,17.011,16]heptadeca-9,11,13,15-tetraen-2-one	present	LOTUS
12-Ethyl-9-oxo-8,16-diazatetracyclo[10.6.1.02,7.016,19]nonadeca-1(19),2,4,6,17-pentaene-17-carbaldehyde	present	LOTUS
16-Epikopsinine	present	LOTUS
18-O'-acetyl 18-O-methyl (1S,10S,12R,13E)-13-ethylidene-8,15-diazapentacyclo[10.5.1.01,9.02,7.010,15]octadeca-2,4,6,8-tetraene-18,18-dicarboxylate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kopsia singapurensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

matKKT955341.1 ↗1 508 bpMalaysia

ACGT

TCCAAAAATATTTACAGCTTGATAGATCTCAACAACCTAGCTTTCTATATCCACTTATCTTTCAGGAGTATATTTATGCACTTGTTCATG …

Kopsia singapurensis voucher Saw 37489 (L) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor41

Museum / vouchered28

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤1 km 8>10 km 33

41 georeferenced

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	1
Auckland, NZ	1
Guangzhou, CN	1
South Kensington, GB	1

4 institutions · 4 of 28 vouchered records shown · 24 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)