Kokia drynarioides

(Seem.) Lewton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Kokia

At a glance

Occurrence records31

Data sources14

Biological traits21

DNA specimens1

eDNA detections1

Sources14 archives

Databases and archives Kokia drynarioides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GIFT · GoaT587 Mbp

01Narrative

Kokia drynarioides, commonly known as Hawaiian tree cotton, is a species of flowering plant in the mallow family, Malvaceae, that is endemic to the Big Island of Hawaii. It inhabits dry forests at elevations of 455 -. Associated plants include āheahea (Chenopodium oahuense), aalii (Dodonaea viscosa), hala pepe (Pleomele hawaiiensis), wiliwili (Erythrina sandwicensis), uhiuhi (Caesalpinia kavaiensis), kōlea (Myrsine lanaiensis), aiea (Nothocestrum latifolium), kuluī (Nototrichium sandwicense), ālaa (Pouteria sandwicensis), ohe kukuluāeo (Reynoldsia sandwicensis), māmane (Sophora chrysophylla), and maua (Xylosma hawaiiense var. hillebrandii). It is threatened by habitat loss and competition with invasive species, such as Fountain Grass (Pennisetum setaceum).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length max30 mm

Leaf length max200 mm

Leaf length min80 mm

Leaf width max200 mm

Leaf width min80 mm

Plant height8 m

Plant height max8 m

Seed length max15 mm

Seed length min12 mm

Seed width max8 mm

Life cycle & reproduction4

Deciduousnessdeciduous

Dehiscencedehiscent

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kokia drynarioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKY569591.1 ↗682 bp

ACGT

AACCTGCCTAGCAGAACGACCCGTGAACGAGTTGTAAACAACACCGGAAGTGGTGTGGGTGCATCCTTGCCTCTCGCCACTTCCTCGTCT …

Kokia drynarioides voucher HAW:Morden1196 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GIFT · GoaT · NCBI

The complete instruction manual Kokia drynarioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size586 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Kokia drynarioides0.59 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Kew Plant DNA C-values Database · CCDB · book-atlas-flowering-plants · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-atlas-flowering-plants

CCDB · kew — Wendel JF, Johnston S, Price HJ. (pers. comm. 1999).

GIFT · GIFT (floras)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type31 records

Wild obs. + sensor21

Museum / vouchered10

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 21

21 georeferenced

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	5
BISHlocation not on record	2
Honolulu, US	2
Northridge, US	1

4 institutions · 10 of 10 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Kokia drynarioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)