Kohautia amatymbica

Eckl. & Zeyh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Kohautia

At a glance

Occurrence records847

Data sources9

Biological traits19

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Kohautia amatymbica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility847 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF847 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Kohautia amatymbica, or tremble tops, is a species of flowering plant in the family Rubiaceae, native to southern Africa. Its roots are edible.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · TRY: 0.375 m

Plant height max0.6 m

Plant height min0.15 m

Seed mass0.081 mg

Seed mass max0.08 mg

Seed mass min0.08 mg

Life cycle & reproduction3

Life formannual or subshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 200 m

Elevation min105 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Kohautia amatymbica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAM939484.1 ↗770 bp

ACGT

GTGTTCGGATTGCGGCGACGTGAGCGGTTCGCCGCCCGCGACGTCGCAAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCG …

Kohautia amatymbica ITS1, 5.8S rRNA gene and ITS2, specimen voucher Bremer et al. 4307 (UPS)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★trnL★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Kohautia amatymbica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 541×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kiehn, M. 1985. Karyosystematische Untersuchungen an Rubiaceae: Chromosomenzählungen aus Afrika, Madagaskar und Mauritius. Pl. Syst. Evol. 149: 89–118.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type847 records

Wild obs. + sensor479

Museum / vouchered368

Range

Area of Occupancy AOO2 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 294≤1 km 79≤10 km 9>10 km 13

395 georeferenced · 84 without coordinates

Open the mapobservation + sensor479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 365 without coordinates

Open the institutions mapphysical evidence368

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	247
Durban, ZA	92
Cape Town, ZA	12
University of Stellenboschlocation not on record	2
Stockholm, SE	1
Bronx, US	1
Kew, GB	1
South African National Biodiversity Institutelocation not on record	1
CASlocation not on record	1
Görlitz, DE	1
MSB-3054location not on record	1
Moscow State Universitylocation not on record	1

12 institutions · 361 of 368 vouchered records shown · 6 without an institution code

09Environmental DNA3 detections

Where the DNA of Kohautia amatymbica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)26.6 °C

Min temp (night)11.7 °C

Precipitation34.5 mm/mo

Air humidity48.3 %

Moisture balance-98.6 mm/mo

Vapour deficit1,186 Pa

Wind speed2.90 m/s

Cloud cover16.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)